Cells and tissues were homogenized using RiboEXTM reagent (GeneAll; Seoul, Korea), chloroform was added, and the solution was shaken vigorously for 15 min. The aqueous phase was then transferred to fresh tubes, isopropanol was added, and the solution was incubated for 15 min at 4 °C and centrifuged for 15 min at 12,000× g. The supernatants were removed, and the pellets were washed with 75% ethanol and centrifuged for 5 min at 8000× g. The RNA pellets obtained were dried and dissolved in diethylpyrocarbonate water, and the mRNA concentrations were calculated. mRNA was reverse transcribed to cDNA using SuPrimeCript RT Premix (Genetbio Inc.; Daejeon, Korea). Real-time PCR analysis was performed using SYBR green master mix (BIOLINE, London, UK) and the CFX Connect System (Bio-Rad Inc.).
Sybr green master mix
Manufactured by Meridian Bioscience
Sourced in United States, United Kingdom
SYBR Green Master Mix is a ready-to-use solution that contains all the necessary components for real-time PCR amplification and detection, including SYBR Green I dye, DNA polymerase, dNTPs, and buffer. It is designed to provide sensitive and reliable quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Cfx connect system, by Bio-Rad (5 mentions)
Cdna synthesis kit, by Bioneer (3 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Surecycler 8800 thermocycler, by Agilent Technologies (3 mentions)
Tri reagent, by Merck Group (2 mentions)
Lightcycler 96, by Roche (2 mentions)
Oligo deoxythymidine primers, by Merck Group (2 mentions)
Superscript 2 reverse transcriptase, by Merck Group (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Spectrum plant total rna kit, by Merck Group (2 mentions)
Total rna purification kit, by Norgen Biotek (2 mentions)
Suprimecript rt premix, by GeNet Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Riboex reagent, by GeneAll (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Superscript vilo kit, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
31 protocols using sybr green master mix
1
Total RNA Extraction and Real-Time PCR Analysis
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy kit (QIAGEN), and complementary DNA (cDNA) was made from 1 μg using M‐MLV Reverse Transcriptase (Invitrogen) and dN6 primers. For real‐time PCR, we used SYBR Green Master mix (Bioline. Cat. BIO‐94020). Primers are detailed in Table 1 . Technical replicates were carried out for all quantitative PCR. An endogenous control (beta‐actin) was used to normalize expression.
3
C9orf72 Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from ~30 embryos using TriReagent® (Sigma) according to manufacturer’s protocol. In all, 1 µg of RNA was used for cDNA synthesis by the SuperScript®Vilo™ Kit (Invitrogen). RT-qPCR was run with SYBR Green Master Mix (Bioline) using the LightCycler® 96 (Roche). ef1a was used as the reference gene for normalization and following primers were used for C9orf72: FW: 5’-GTGTGCCAGAGGAGGTTGAT-3’; RV:5’-ACAGCTGTCTCCAATATCATCG-3’.
4
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentiated myotubes were washed with cold DPBS and lysed with TRIzol reagent. Chloroform was added for the separation of RNA from DNA and protein fractions. RNA fraction was precipitated by the addition of isopropanol, followed by centrifugation at 12,000g for 8 minutes at 4°C. The RNA pellet was washed with 75% ethanol and centrifuged at 12,000g for 5 minutes at 4°C. After removal of ethanol, RNA pellets were air dried before resuspending with RNAse-free water. The RNA concentration was quantified using a NanoDrop spectrophotometer. Reverse transcription was performed with a cDNA synthesis kit according to manufacturer's instruction (Bioneer, Korea). Following cDNA synthesis, RT-qPCR was performed in a Rea-Time PCR system (Applied Biosystems) using a SYBR Green master mix (Bioline, Korea) and primer pair sets described in Table 1 . Cycle threshold (Ct) values were normalized to the housekeeping gene (HPRT1-F: 5′- GACTTGCTCGAGATGTCATG -3′, HPRT1-R: 5′- TACAGTCATAGGAATGGACC -3′).
5
Myotube RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentiated myotubes were washed with cold DPBS and lysed with TRIzol reagent. Chloroform was added for the separation of RNA from DNA and protein fractions. RNA fraction was precipitated by the addition of isopropanol, followed by centrifugation at 12,000 g for 8 min at 4°C. The RNA pellet was washed with 75% ethanol and centrifuged at 12,000 g for 5 min at 4°C. After removal of ethanol, RNA pellets were air-dried before resuspending with RNAse free water. The RNA concentration was quantified using a NanoDrop spectrophotometer (ND-2000, Thermo Fisher Scientific, USA). Reverse transcription was performed with a cDNA synthesis kit according to the manufacturer’s instruction (Bioneer, Korea). Following complementary DNA synthesis, qRT-PCR was performed in 7500 Real-Time PCR system (Applied Biosystems, USA) using a SYBR Green Master Mix (Bioline, Korea), and the primer pair sets are described in Table 1 . Cycle threshold (Ct) values were normalized to the housekeeping gene (HPRT1-F, 5'-GACTTGCTCGAGATGTCATG-3'; HPRT1-R, 5'-TACAGTCATAGGAATGGACC-3').
6
Kidney RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen kidneys using Trizol-reagent (Sigma-Aldrich). cDNA was synthesized using M-MLV reverse transcriptase and oligo-dT primers. Transcript analysis was performed by real-time quantitative PCR on the Roche Light Cycler 480 using SYBR green master mix (Bioline). Relative expression was analyzed using LinRegPCR (developed by Hearth failure research center, University of Amsterdam, the Netherlands). Gene expression was normalized to murine Peptidylprolyl Isomerase A (Ppia) and Tata Box binding Protein (Tbp) housekeeping genes. Murine primer sequences are listed in Supplementary Table 1 .
7
Quantitative PCR Protocol for Cardiac Myocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SuperScript III First-Strand Synthesis Reverse Transcriptase (Life Technologies) was used to reverse transcribe poly(A) RNA to cDNA. qPCR reactions were performed using SYBR Green master mix (SensiFAST, Bioline) in a LightCycler 480 machine (Roche). Threshold cycle (Ct) and melting curve measurements were determined by LightCycler 480 software. Each qPCR sample had at least three technical replicates on the same qPCR plate. Rplp0 was used as housekeeping gene and Ct values were normalized to mock-transfected (no oligo, lipofectamine only) samples. P values from Student’s t-test and error bars represent s.e.m. Five biological replicates of adult isolated TAC CMs were used for qPCR analysis of each gene. Primers used are listed in Supplementary Table 5 .
8
RNA Extraction and qPCR Analysis of Muscle Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the soleus and plantaris muscles using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA). The RNA concentration and quality were measured at 260/280 nm using a spectrophotometer (Nanodrop-2000, Thermo Fisher Scientific, Waltham, MA). Subsequently, cDNA was synthesized from 1 μg of total RNA in the presence of a random primer, 2.5 mM dNTP, RNase inhibitor and reverse transcriptase (Invitrogen Life Technologies) in a final volume of 20 μg at 25°C for 10 min, followed by 42°C for 60 min, and 95°C for 5 min. Real-time quantitative polymerase chain reaction (qPCR) was performed using the Step-One-Plus system (Applied Biosystems, Foster City, CA). The qPCR was performed using SYBR Green Master Mix (Bioline, London, UK), according to the manufacturer’s instructions. Primer sets for the target genes are listed in Table 1 . The primers were purchased from Macrogen (Macrogen Inc., Seoul, KOREA). Expression of target genes was normalized to that of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative expression of all genes was calculated using comparative cycle threshold (CT) method.
9
HUVEC Total RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HUVECs by using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA). RNA samples were quantified at 260 nm. RNA samples with A260/A280 ratios ≥1.7 were selected. First-strand cDNAs were synthesized from 2 µg total RNA by using SuperScript II reverse transcriptase and oligo deoxythymidine primers (Sigma-Aldrich). Reverse transcription was performed with a Surecycler 8800 thermocycler (Agilent Technologies, Santa Clara, CA, USA), and reverse transcription products were amplified by SYBR Green master mix (BioLine, London, United Kingdom) in a total volume of 20 µl by using the primer set and conditions described previously (36 (link)) (Supplemental Data ). Housekeeping gene GAPDH (glyceraldehyde 3-phosphate dehydrogenase) was used for normalizing gene expression.
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentiated myotubes were washed with cold DPBS and lysed with TRIzol reagent. Chloroform was added for the separation of RNA from DNA and protein fractions. The RNA fraction was precipitated by the addition of isopropanol, followed by centrifugation at 12,000g for 8 minutes at 4°C. The RNA pellet was washed with 75% ethanol and centrifuged at 12,000g for 5 minutes at 4°C. After removal of the ethanol, the RNA pellets were air-dried before resuspending with RNAse free water. The RNA concentration was quantified using a NanoDrop spectrophotometer (NanoDrop Technologies, DE, USA). Reverse transcription was performed with a cDNA synthesis kit according to manufacturer's instruction (Bioneer, Daejeon, Korea). Following complementary DNA synthesis, qRT-PCR was performed in a Real-Time PCR system (Applied Biosystems, CA, US) using a SYBR Green Master Mix (Bioline, Hanam, Korea), and the primer pair sets were described in Table 1 . Cycle threshold (Ct) values were normalized to the housekeeping gene (HPRT1-F: 5′- GACTTGCTCGAGATGTCATG -3′, HPRT1-R: 5′- TACAGTCATAGGAATGGACC -3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!