Reverse transcriptase

Manufactured by Roche

Sourced in United States, Germany, Switzerland

Reverse transcriptase is an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from a single-stranded RNA template. This enzyme plays a crucial role in the process of reverse transcription, which is an essential step in the life cycle of retroviruses, such as HIV.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Transcriptor Reverse Transcriptase (160 citations) Transcriptor Reverse Transcriptase kit (30 citations) Colorimetric reverse transcriptase assay (12 citations) SuperScript III Reverse Transcriptase (9 citations) MuLV reverse transcriptase (6 citations) Avian myeloblastosis virus reverse transcriptase (5 citations) Reverse Transcriptase Assay Colorimetric Kit (5 citations) M-MLV reverse transcriptase kit (5 citations) Transcriptor reverse transcriptase system (4 citations) Reverse transcriptase assay (4 citations)

34 protocols using reverse transcriptase

RT-qPCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using TRIzol reagent (Invitrogen) followed by purification and DNAse I-treatment on a mini column (Qiagen) as per the manufacturer's instructions. RNA was reverse transcribed using reverse transcriptase (Roche) and cDNA was used in a quantitative RT–PCR reaction using SYBR Green PCR master mix (Applied Biosystems) and a Step One real-time PCR machine (Applied Biosystems). Gapdh was used as control gene (Table 2).

Table 2.

Primers used in this study

qRT–PCR
Oxr1 FL-F	CAGTCGTGACTGGACAGGT
Oxr1 FL-R	ATGGGCTACATCTGGAGTCG
Oxr1 C-F	CCATAAATACACTCTGGTAGTGTCG
Oxr1 C-R	TTTGGTCGGAAAGATTCAGG
Tdp-43-F	CTCCCCTGGAAAACAACTGA
Tdp-43-R	AAAGCCAAACCCTTTCGAGT
Fus-F	CCTAGCAGCACCTCAGGAAG
Fus-R	CGTAGTTTGTTGCTGTCCA
Splicing
Mapt1-F	TCCCCCTAAGTCACCATCAG
Mapt1-R	GCCAATCTTCGACTGGACTC
Opa1-F	GGAGAAACAGCATTTCGAGC
Opa1-R	GCAGAAGTTCTTCTTGAAGTTGG
Mtfr1- F	TGATTCAGTGTCCAAGAGTTCAA
Mtfr1-R	CTTCTGCAGGGCCTCCTCGCT
Tab1b-F	CCCCAACACCAAGATCAACT
Taf1b-R	AGGCCTGTTTGCTCTTCTGA
Tia1-F	TGAAAGTGAATTGGGCAACA
Tia1-R	TGCCCTTTAGGTGGTGAAAG
Scl1a2-F	ACCGAATGCAGGAAGACATG
Scl1a2-R	GGCTGAGAATCGGGTCATTA
Eif4h-F	ACTTCGTGTGGACATTGCAG
Eif4h-R	CCCCCTACCCCCTAAGAAGT

Finelli M.J., Liu K.X., Wu Y., Oliver P.L, & Davies K.E. (2015). Oxr1 improves pathogenic cellular features of ALS-associated FUS and TDP-43 mutations. Human Molecular Genetics, 24(12), 3529-3544.

+ Open protocol

+ Expand

Quantifying AKT, PI3K, and mTOR Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted according to the total RNA Extraction Kit procedure (Omega, GA) and subjected to reverse transcription using reverse transcriptase (Roche, Basel, Switzerland) and SYBR Premix ExTaq kit (Takara, Dalian, China). The gene-specific primers were as follows: AKT forward, 5′-CTTGCTTTCAGGGCTGCTCA-3′ and reverse, 5′-TACACGTGCTGCCACACGATAC-3′; PI3K forward, 5′-CTGTCAATCGGTGACTGTGTGG-3′ and reverse, 5′-AAACAGGTCAATGGCTGCATCATA-3′; mTOR forward, 5′-AGAAACTGCACGTCAGCA CCA-3′ and reverse, 5′-CCATTCCAGCCAGTCATCTTTG-3′; β-actin forward, 5′-GCTTCTAGGCGGACTGTTAC-3′ and reverse, 5′-CCATGCCAATGTTGTCTCTT-3′. Samples were amplified by the Applied Biosystems 7500 Real-Time PCR System (Life Technologies Corporation, Carlsbad, CA). The conditions of qRT-PCR were as follows: 95 °C initial denaturation for 1 min, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (40 s at 60 °C). Each sample was amplified in triplicate. The results were calculated using the 2^–ΔΔCt method.

Zhu Y., Zhong Y., Long X., Zhu Z., Zhou Y., Ye H., Zeng X, & Zheng X. (2019). Deoxyshikonin isolated from Arnebia euchroma inhibits colorectal cancer by down-regulating the PI3K/Akt/mTOR pathway. Pharmaceutical Biology, 57(1), 412-423.

+ Open protocol

+ Expand

HIV-1 Infection and DING p27SJ Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from U-87 MG cells or primary microglial cells, transfected with DING p27SJ and infected with HIV-1, with the RNAqueous^® total RNA Isolation Kit (Ambion, Austin, TX, USA). One μg of RNA was used to generate cDNA with reverse transcriptase (Roche Molecular Biochemicals, IN). The cDNA amplification with 28 cycles of PCR was performed using Taq DNA polymerase. PCR products were studied by DNA gel electrophoresis in 1.5% agarose gel.

Darbinian N., Darbinyan A., Merabova N., Gomberg R., Chabriere E., Simm M., Selzer M.E, & Amini S. (2020). DING Protein Inhibits Transcription of HIV-1 Gene through Suppression of Phosphorylation of NF-κB p65. Journal of HIV and AIDS, 6(1), 175.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using RNeasy Plus Mini Kit (Qiagen). First-strand cDNA was synthesized from 2 μg of total RNA using reverse transcriptase (Roche). Quantitative PCR (qPCR) was performed in a 20 μl reaction mixture containing 10 μl of SYBR Green Master Mix (Applied Biosystems), 5 μl of 1 mM primers, and 100 ng of cDNA templates using a Bio-Rad CFT Connect thermocycler. Data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used in qPCR (S5 Table) were synthesized by IDT.

Khalil M.I., Yang C., Vu L., Chadha S., Nabors H., Welbon C., James C.D., Morgan I.M., Spanos W.C, & Pyeon D. (2023). HPV upregulates MARCHF8 ubiquitin ligase and inhibits apoptosis by degrading the death receptors in head and neck cancer. PLOS Pathogens, 19(3), e1011171.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Arg-1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent and quantified using UV spectrophotometer. For real-time PCR analysis of mRNA expression, 1.0 μg of total RNA (in 20 μl reaction volume) was reverse transcribed using reverse transcriptase (Roche Diagnostic Corp., Indianapolis, IN, USA) and oligo-dT primers in a standard reaction. The quantitative real-time polymerase chain reaction was performed by use of a LightCycler (Roche), with primers specifically designed for Arg-1 (Forward:5′-CTCTAAGGGACAGCCTCGAGGA-3′, Reverse: 5′-TGGGTTCACTTCCATGATATCTA-3′; Applied Biosystem) according to the gene manufacturer's recommended protocol. Each reaction was run in triplicate. Samples were quantified accordingly (LightCycler analysis software, version 3.5) using the housekeeping gene GAPDH (Forward: 5′-CCAGCCGAGCCACATCGCTC-3′, Reverse: 5′-ATGAGCCCCAGCCTTCTC-3′; Roche) as standard.

Romano A., Parrinello N.L., Vetro C., Tibullo D., Giallongo C., La Cava P., Chiarenza A., Motta G., Caruso A.L., Villari L., Tripodo C., Cosentino S., Ippolito M., Consoli U., Gallamini A., Pileri S, & Di Raimondo F. (2016). The prognostic value of the myeloid-mediated immunosuppression marker Arginase-1 in classic Hodgkin lymphoma. Oncotarget, 7(41), 67333-67346.

+ Open protocol

+ Expand

Quantitative Analysis of p62 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

WT and pex5^−/− livers were dissected from six- or 7-day-old larvae. Each sample of total RNA was prepared from ten livers at the desired developmental stages using TRIzol reagent (Ambion Inc., Austin, TX, USA), following the manufacturer’s instructions. Total RNA was reverse-transcribed using reverse transcriptase (Roche, Basel, Switzerland), and quantitative PCR (qPCR) was performed using the following primers: p62 F:5ʹ-GCGTCAGTGAGGGAACAAAG-3ʹ, R:5ʹ-CAGAGACTCCACCAGCCTAG-3ʹ; and β-actin F:5ʹ-TGAATCCCAAAGCCAACAGAGAGA-3ʹ, R:5ʹ-TCACGACCAGCTAGATCCAGACG-3ʹ. The data were analyzed to determine the relative abundance of β-actin. All analyses were performed in triplicate.

Bhandari S., Kim Y.I., Nam I.K., Hong K., Jo Y., Yoo K.W., Liao W., Lim J.Y., Kim S.J., Um J.Y., Kim P.K., Lee H.S., Ryu D., Kim S.H., Kwak S., Park R, & Choe S.K. (2023). Loss of pex5 sensitizes zebrafish to fasting due to deregulated mitochondria, mTOR, and autophagy. Cellular and Molecular Life Sciences, 80(3), 69.

+ Open protocol

+ Expand

RNA Isolation, cDNA Synthesis, and qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation, cDNA synthesis, and qPCR primers were described^{50 (link)}. In brief, RNA was harvested from 2×10⁶ cells using High Pure RNA Isolation Kit. cDNA libraries were generated with reverse transcriptase (Roche). qPCR was performed on a Roche LightCycler 480 instrument. The housekeeping gene TBP was used for normalization.

Cheng A.Z., Yockteng-Melgar J., Jarvis M.C., Malik-Soni N., Borozan I., Carpenter M.A., McCann J.L., Ebrahimi D., Shaban N.M., Marcon E., Greenblatt J., Brown W.L., Frappier L, & Harris R.S. (2018). Epstein-Barr virus BORF2 inhibits cellular APOBEC3B to preserve viral genome integrity. Nature microbiology, 4(1), 78-88.

+ Open protocol

+ Expand

Quantification of Mouse Klf4 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using an RNeasy Mini Kit (QIAGEN, CA) as instructed. RNA (500–1000ng) was reverse transcribed
using a Reverse Transcriptase (Roche Applied Science, Indianapolis, IN) and relative changes in mouse Klf4 mRNA quantified by
real-time qPCR. Primers for Klf4 were: (F) 5′-ATCACGAAGTGGTGAAGTTC-3′ and (R)
5′-TGCTGTAGGAAGCTCATCTC-3′ producing a 176bp product. Primers specific for mActin were: (F)
5′-GTCGACACAGTGGCCATCAGCAGTT-3′ and (R) 5′-TTCCACAGAGCCCTTCTGGTT-3′ producing a 219bp product.
Appropriately sized amplicons for all genes of interest were verified by gel electrophoresis and melting curve analyses (data
not shown). All gene expression was normalized to mActin expression within each experiment, and relative changes in expression
calculated by the 2^−ΔΔCT formula. PCR reactions were performed in the iQ5 Real-Time PCR
Detection System with iQ SYBR Green Master Mix (Thermo Fisher Scientific, MA). The cycling conditions for all the genes were:
95°C for 4.5 min, 40 cycles of 95°C for 30 s, 60°C for 20 s, and 72°C for 30 s.

Xiong X., Schober M., Tassone E., Khodadadi-Jamayran A., Sastre-Perona A., Zhou H., Tsirigos A., Shen S., Chang M., Melamed J., Ossowski L, & Wilson E.L. (2018). KLF4, A Gene Regulating Prostate Stem Cell Homeostasis, Is a Barrier to Malignant Progression and Predictor of Good Prognosis in Prostate Cancer. Cell reports, 25(11), 3006-3020.e7.

+ Open protocol

+ Expand

Quantifying Autophagy-Related Genes in Neutrophils

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from neutrophils using Trizol reagent and quantified using a UV spectrophotometer. One microgram of total RNA (in 20 μL reaction volume) was reverse-transcribed in cDNA using reverse-transcriptase (Roche Diagnostic Corp., Indianapolis, IN, USA) and oligo-dT primers in a standard reaction. The quantitative real-time polymerase chain reaction (RT-PCR) of the resultant cDNA was performed using a LightCycler (Roche),with 300 nM primers designed specifically for the transcripts of hATG10 FW: TACGCAACAGGAACATCCAA; hATG10 RV: AACAACTGGCCCTACAATGC; hATG12 FW: CAGTCGCTACTTCCGCTCTCGAG; hATG12 RV: AAACAATGTTCTGAGGCCACAAG; hMAP1LC3B FW: GAACGATACAAGGGTGAGAAGC; hMAP1LC3B RV: AGAAGGCCTGATTAGCATTGAG; GABARAP FW: ACACTGACAATTTCATCCCG; hGABARAP RV: GCCTTTCCCA TCCTGCTGTA; hSQSTM1 FW: GGGGCGCCCTGAGGAACAGA; hSQSTM1 RV: CCTGGTGAGCCAGCCGCCTT; hOPTN FW: TTCGGCCTGGACAGAGAAAC; hOPTN RV: TGCCTTCTCTGCTTGTAGCC, according to the gene manufacturer’s recommended protocol (Applied Biosystem). Each reaction was run in triplicate. Samples were quantified accordingly (LightCycler analysis software, version 3.5) using the housekeeping gene GAPDH (Fw: TCCTGTTCGACAGTCAGCCGCA, Rv: GCGCCCAATACGACCAAATCCGT) as standard.

Puglisi F., Parrinello N.L., Giallongo C., Cambria D., Camiolo G., Bellofiore C., Conticello C., Del Fabro V., Leotta V., Markovic U., Sapienza G., Barbato A., Scalese S., Tibullo D., Brundo M.V., Palumbo G.A., Di Raimondo F, & Romano A. (2019). Plasticity of High-Density Neutrophils in Multiple Myeloma is Associated with Increased Autophagy Via STAT3. International Journal of Molecular Sciences, 20(14), 3548.

+ Open protocol

+ Expand

RNA Isolation and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissue samples using RNeasy (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The reverse transcription reaction was done using a reverse transcription kit (Reverse Transcriptase, Roche Diagnostics) following the manufacturer’s protocol.

Mohammed A.A., Rashed H.E., Abdelrahman A.E., Obaya A.A., Toam M., Nour H.M., Abdelhamid M.I, & Elsayed F.M. (2019). C-MYC and BCL2: Correlation between Protein Over-Expression and Gene Translocation and Impact on Outcome in Diffuse Large B Cell Lymphoma. Asian Pacific Journal of Cancer Prevention : APJCP, 20(5), 1463-1470.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!