Rneasy microrna isolation kit

Manufactured by Qiagen

Sourced in United States, Japan

The RNeasy microRNA isolation kit is a lab equipment product designed to extract and purify microRNA (miRNA) from a variety of sample types, including cultured cells, tissues, and body fluids. The kit utilizes a silica-based membrane technology to efficiently capture and elute miRNA molecules, providing a convenient and reliable method for miRNA isolation.

Automatically generated - may contain errors

Lab products found in correlation

31 protocols using rneasy microrna isolation kit

Developmental Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the developmental expression analysis, total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA, and cDNAs were synthesized using Superscript IV VILO (Invitrogen, Cat#11756050). RT-qPCR was performed using TAQMAN FAST ADVANCED MMIX (Applied Biosystems, Cat#4444557) using custom designed Taqman Probes for Nppa (Assay ID: AP2XD4X), Nppb (Assay ID: APZTJJZ), Nppc (Assay ID: APWC2U2), Npr1 (Assay ID: APPRPKU), Npr2 (Assay ID: AP327PV), Npr3 (Assay ID: AP472AT) and Odc (Assay ID: APCFAEF).
For animal caps, total RNA was extracted from 12 explants using RNeasy microRNA isolation kit (Qiagen, Valencia, CA) and the RNA samples were digested with RNase-free DNase I to eliminate genomic DNA. RT-qPCR analysis was performed using Power SYBR Green RNA to C_T 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the following primer sets: Six1 (F: ctggagagccaccagttctc; R: agtggtctccccctcagttt), Eya1 (F: atgacaccaaatggcacaga; R: gggaaaactggtgtgcttgt), Sox10 (F:CTGTGAACACAGCATGCAAA; R:TGGCCAACTGACCATGTAAA), Snai2 (F: CATGGGAATAAGTGCAACCA; R: AGGCACGTGAAGGGTAGAGA) and Odc (F: ACATGGCATTCTCCCTGAAG; R: TGGTCCCAAGGCTAAAGTTG).

Devotta A., Juraver-Geslin H., Griffin C, & Saint-Jeannet J.P. (2023). Npr3 regulates neural crest and cranial placode progenitors formation through its dual function as clearance and signaling receptor. eLife, 12, e84036.

+ Open protocol

+ Expand

Transcriptome analysis of granulosa and testis cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified by the RNeasy micro-RNA Isolation Kit (Qiagen, Valencia, CA, USA), and then reverse transcribed into cDNA by the QuantiTect Reverse Transcription System (Qiagen). qRT-PCR was conducted and analyzed on an ABI 7500 instrument (Applied Biosystems, CA, USA) using a standard protocol. For single-cell RNA-seq analysis, RNA was extracted from granulosa cells of 14-day-old WT and KO mice, and transcriptome analysis was performed by Annoroad Gene Technology Co., Ltd. (Beijing, China). For RNA-seq analysis, RNA was extracted from testes of 21-day-old WT and KO mice, and analyzed by Annoroad Gene Technology Co., Ltd. (Beijing, China). The RNA-seq data were partially verified by qRT-PCR and western blotting. The qRT-PCR primers are listed in Supplementary Table S2.

Yuan F., Wang Z., Sun Y., Wei H., Cui Y., Wu Z., Zhang C., Xie K.P., Wang F, & Zhang M. (2021). Sgpl1 deletion elevates S1P levels, contributing to NPR2 inactivity and p21 expression that block germ cell development. Cell Death & Disease, 12(6), 574.

+ Open protocol

+ Expand

Oocyte RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from collected oocytes using an RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA, U.S.) following the manufacturer’s instructions. The RNA concentrations were measured using a Nanodrop ND-1000 Spectrophotometer (Biolab, Scoresby, Victoria, Australia). Reverse transcription was conducted to generate cDNA libraries using a QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. QRT-PCR and RT-PCR were performed using an ABI 7500 real-time PCR instrument or a Veriti 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, U.S.). The sequences of all primers used are listed in Additional file 3: Table S2. The results were analyzed using the 2^−ΔΔCt method.

Zhao L., Lu T., Gao L., Fu X., Zhu S, & Hou Y. (2017). Enriched endoplasmic reticulum-mitochondria interactions result in mitochondrial dysfunction and apoptosis in oocytes from obese mice. Journal of Animal Science and Biotechnology, 8, 62.

+ Open protocol

+ Expand

Quantification of Gene Expression in Porcine Reproductive Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of porcine spermatozoa, ampullary epithelial cells, oocytes, and cumulus cells was extracted using the RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. RNA (no more than 1 μg) was reverse transcribed into cDNA using the QuantiTect Reverse Transcription System (Qiagen, Valencia, CA, USA). qRT-PCR was conducted using a Light Cycler 96 instrument (Roche, Basel, Switzerland). Relative gene expression was quantified using the threshold cycle value and normalized using GAPDH as a housekeeping gene. Primer sequences are listed in Supplementary Table S4.

Wu Z., Li B., Yu K., Zheng N., Yuan F., Miao J., Zhang M, & Wang Z. (2023). The Mature COC Promotes the Ampullary NPPC Required for Sperm Release from Porcine Oviduct Cells. International Journal of Molecular Sciences, 24(4), 3118.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using a RNeasy microRNA isolation kit (Qiagen, Valencia, CA, U.S.) following the manufacturer's instructions. Samples were treated with DNase I, and then, Transcript-Uni Cell was used for cDNA synthesis. A quantitative PCR supermix was used for the assays (Transgene Biotech, Beijing, China). RNA concentrations were measured using a Nanodrop 2000 Spectrophotometer (Biolab, Scoresby, Victoria, Australia) at a wavelength of 260 nm. Samples for subsequent analyses were only used if their 260 : 280 nm absorbance ratios were >1.8. Quantitative- and reverse transcription-PCR assays were performed with an ABI 7500 real-time PCR instrument and a Fast 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, U.S.), respectively. Three replicates were conducted for all assays. The relative expression of genes was calculated by the comparative threshold cycle method as 2^−ΔΔCt. The primers used for the amplification assays are shown in Table 2.

Zhang L., Liu K., Zhuan Q., Liu Z., Meng L., Fu X., Jia G, & Hou Y. (2022). Mitochondrial Calcium Disorder Affects Early Embryonic Development in Mice through Regulating the ERK/MAPK Pathway. Oxidative Medicine and Cellular Longevity, 2022, 8221361.

+ Open protocol

+ Expand

Gene Expression Analysis in Animal Explants

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each sample total RNAs were extracted from 10 animal explants using an RNeasy micro RNA isolation kit (Qiagen, Valencia CA) according to the manufacturer’s direction. qRT-PCR was performed using primers for snail2, sox2, keratin, Ef1α (Hong and Saint-Jeannet, 2007 (link)) and znf703 (F: TCCCTCCTCCAAATGAACTG; R: GTGCAGCAAGTGTCCTGTGT) on a LightCycler (Roche, Inndianapolis IN) or QuantStudio 3 (Applied Biosystems; ThermoFisher Scientific, USA), as described (Hong and Saint-Jeannet, 2007 (link)).

Hong C.S, & Saint-Jeannet J.P. (2017). Znf703, a novel target of Pax3 and Zic1, regulates hindbrain and neural crest development in Xenopus. Genesis (New York, N.Y. : 2000), 55(12), 10.1002/dvg.23082.

+ Open protocol

+ Expand

Quantifying gene expression in islet cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA (0.5–1 μg) was used for reverse transcription, and RT-PCR analysis was conducted using The iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. #172-5124) on the 7500 Applied Biosystems Real-Time System. Primers are listed in Supplementary Table 1. The efficiency of primer pairs in the PCR was determined as described (17 (link)). RNA from human and rat islet cells was extracted using the RNeasy microRNA isolation kit (Qiagen, Cat. #74004).

Zhang P., Kumar A., Katz L.S., Li L., Paulynice M., Herman M.A, & Scott D.K. (2015). Induction of the ChREBPβ Isoform Is Essential for Glucose-Stimulated β-Cell Proliferation. Diabetes, 64(12), 4158-4170.

+ Open protocol

+ Expand

Quantification of Cumulus Cell Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of cumulus cells from cultured COCs was isolated and purified from frozen samples using the RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed directly after RNA isolation using the QuantiTek reverse transcription system (Qiagen). Real-time PCR was then conducted to quantify the steady-state mRNA levels using an ABI 7500 Real-time PCR instrument (Applied Biosystems, Foster City, CA, USA). The results were first normalized to the expression levels of a housekeeping gene, β-actin, using the 2^−ΔΔCt method [21] (link), and the transcript expression levels were presented as the ratio of the treatment groups to controls. PCR primer sequences were as follows: Areg: 5′-GGTCTTAGGCTCAGGCCATTA-3′ (forward) and 5′-CGCTTATGGTGGAAACCTCTC-3′ (reverse); Ereg: 5′-TTGGGTCTTGACGCTGCTTT-3′ (forward) and 5′-GGATCACGGTTGTGCTGATAA-3′ (reverse); Btc: 5′- AATTCTCCACTGTGTGGTAGCA-3′ (forward) and 5′-GGTTTTCACTTTCTGTCTAGGGG-3′ (reverse). To avoid false-positive signals, dissociation curve analyses were performed at the end of the amplification, and the PCR products were subjected to agarose gel electrophoresis to confirm the sizes. The reactions were conducted at least twice.

Chen Q., Zhang W., Ran H., Feng L., Yan H., Mu X., Han Y., Liu W., Xia G, & Wang C. (2014). PKCδ and θ Possibly Mediate FSH-Induced Mouse Oocyte Maturation via NOX-ROS-TACE Cascade Signaling Pathway. PLoS ONE, 9(10), e111423.

+ Open protocol

+ Expand

Quantification of Ovarian Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse ovaries, cultured follicles, and COCs were collected in 350 μl of RNeasy lysis buffer. The tissues and cells were stored at −80 °C until analysis for mRNA expression. Total RNA was isolated from frozen samples using the RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA, USA), as recommended by the manufacturer’s instructions. Reverse transcription and real-time PCR was then carried out to quantify the steady-state mRNA levels of NPPC, NPR2, M-CSF, and M-CSF-R using an ABI 7500 real-time PCR instrument (Applied Biosystems, Foster City, CA, USA). The housekeeping gene, Rpl19, was considered the internal control. The primers for real-time PCR of NPPC, NPR2, M-CSF, M-CSF-R, and Rpl19 are listed in Table 1. The levels of NPPC, NPR2, M-CSF, and M-CSF-R mRNA were first normalized to the level of Rpl19 expression, then demonstrated relative to a control group in which the level of expression was set at 1. Each experiment was repeated independently at least three times.Table 1

Primer sequences, forward (F) or reverse (R), used for quantitative RT-PCR

Gene	F or R	Primer sequence
NPPC	F	GGGAGCCAATCTCAAGGGAG
	R	GTTGCCGCCTTTGTATTTGC
NPR2	F	GCATTGTCACCGAGTATTGTCC
	R	CAGACCGTAATCTGTTATTTTGAGC
M-CSF	F	TGATTGGGAATGGACACCTG
	R	AAAGGCAATCTGGCATGAAGT
M-CSF-R	F	GGTGGCTGTGAAGATGCTAAAG
	R	AGGCTCCCAAGAGGTTGACTAT
Rpl19	F	CCGCTGCGGGAAAAAGAAG
	R	CAGCCCATCCTTGATCAGCTT

Sun W., Liu C., Feng Y., Zhuo G., Zhou W., Fei X, & Zhang Z. (2017). Macrophage colony-stimulating factor (M-CSF) is an intermediate in the process of luteinizing hormone-induced decrease in natriuretic peptide receptor 2 (NPR2) and resumption of oocyte meiosis. Journal of Ovarian Research, 10, 68.

+ Open protocol

+ Expand

RNA Isolation and Gene Expression Analysis in GV Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 40 collected GV oocytes using a RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA, and U.S.) following the manufacturer instructions. The RNA concentrations were measured using a NanoDrop 2000 Spectrophotometer (Biolab, Scoresby, Victoria, Australia) at wavelength of 260 nm. We wouldn't use the samples for subsequent analyses until their absorbance ratio at 260 nm: 280 nm >1.8.
Reverse transcription was conducted to generate cDNA libraries using a Quantitated Reverse Transcription Kit (Qiagen) according to the manufacturer instructions and we treated the sample with DNaseI before that. QRT-PCR and RT-PCR were performed using an ABI 7500 real-time PCR instrument and a Fast 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, U.S.). The sequences of all primers used are listed in Supplementary Table 1. The relative expression of genes was calculated with the comparative threshold cycle (CT) method as 2^−ΔΔCT.

Zhang L., Wang Z., Lu T., Meng L., Luo Y., Fu X, & Hou Y. (2020). Mitochondrial Ca2+ Overload Leads to Mitochondrial Oxidative Stress and Delayed Meiotic Resumption in Mouse Oocytes. Frontiers in Cell and Developmental Biology, 8, 580876.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!