Phylogenetic assay was determined by analyzing genomic (rDNA, ITS1) and mitochondrial DNA (mtDNA ND1 and CO1). For this propose, 27 amplicons, representing each unique RFLP profile, were selected. Furthermore, the different RFLP-PCR products were purified using the AccuPrep® Gel Purification Kit (Bioneer; Korea) according to the manufacturer’s guidelines. The concentration of DNA was estimated by comparison with a DNA Marker (100bp) in 3.5% agarose gel. All resulting PCR products were sequenced by targeting genes (ND1, COX1, and ITS1) in both directions using the said primers by the ABIPRISMTM 3130 Genetic Analyzer automated sequencer (Applied Biosystems, USA). All sequences were compared with sequences of E. granulosus available in GenBank sequences of all regional species using the Chromas software (version 3.1). The nucleotide sequence analysis was done using the BLAST algorithms from the National Center for Biotechnology. Phylogenetic trees and progression analyses were constructed using Tamura 3- parameter option of the neighbor-joining model with MEGA6 software (52 (link)). Taenia multicepes (JX535576) were used as an out-group. The bootstrap scores were calculated for 2000 replicates.
Accuprep gel purification kit
Manufactured by Bioneer
Sourced in Lithuania, Cameroon
The AccuPrep® Gel Purification Kit is a laboratory instrument used for the extraction and purification of DNA fragments from agarose gels. It provides a reliable and efficient method to isolate DNA of interest from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Dntps, by Takara Bio (2 mentions)
Ex taq dna polymerase, by Takara Bio (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Miseq platform, by Illumina (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Ex tag buffer, by Takara Bio (1 mentions)
Gel document image system, by Bio-Rad (1 mentions)
Iproof high fidelity taq dna polymerase, by Bio-Rad (1 mentions)
Abi 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Dinitrosalicylic acid, by Merck Group (1 mentions)
Beechwood xylan, by Tokyo Chemical Industry (1 mentions)
Accuprep plasmid miniprep dna extraction kit, by Bioneer (1 mentions)
Endo 1 4 β xylanase, by Megazyme (1 mentions)
Qiaamp dna stool mini kit, by Qiagen (1 mentions)
Seakem le agarose for gel electrophoresis, by Lonza (1 mentions)
Primestar hs dna polymerase, by Takara Bio (1 mentions)
Pgh plasmid, by Bioneer (1 mentions)
Dntps, by CinnaGen (1 mentions)
Taq dna polymerase, by CinnaGen (1 mentions)
41 protocols using accuprep gel purification kit
1
Phylogenetic Characterization of Echinococcus
2
Universal Fish COI Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The universal fish primer, BCL-BCH (Baldwin et al. 2009 , Handy et al. 2011 ), used to obtain the partial sequences of cytochrome c oxidase I (COI) region. The PCR mixture (20µL) contained 11.2 µL ultra-pure water, 1 µL primer forward and reversed (0.5 µM), 0.2 µL Ex Taq DNA polymerase (TaKaRa, Japan), 2 µL 10X ExTag Buffer, 2 µL dNTPs (1 µM, TaKaRa, Japan). This PCR reaction, we used 2 µL genomic DNA as a template. The PCR condition was carried out under the following setting: 95 o C for 5 min in initial denaturation. After that, denaturation performed at 95 o C for 30 s in 40 cycles, followed by 50 o C for 30 s in annealing and 72 o C for 45 s in extension step. The final step of PCR are final extension at 72 o C for 5 min. The PCR products of COI was purified with the AccuPrep®Gel purification kit (Bioneer, Korea).
3
Amplification and Cloning of recA Gene Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 780 bp DNA fragment with deletion of the N and C-terminus of the recA gene was amplified from the genomic DNA of GV2260 using primers: recA For, 5′-caccatcgatcatgaagctcggt-3′ and recA Rev, 5′-gcgccggacttctcgacgat-3′. The PCR reaction as performed using the iProof™ high fidelity Taq DNA polymerase (Bio-Rad, Hercules, CA). The PCR program consisted of 1 cycle at 98°C (2 min), followed by 30 cycles at 98°C (30 s), 55°C (45 s), and 72°C (1 min), and finished with a 1 cycle extension at 72°C (7 min). The PCR product was separated on a 0.8% agarose gel, stained with 0.01% ethidium bromide solution, and visualized using the Gel-Document Image System™ under UV light (Bio-Rad).
The PCR product was purified using the AccuPrep™ Gel Purification Kit (Bioneer, Alameda, CA) and cloned into the TopoEntr/D™ vector (Invitrogen, Carlsbad, CA) following the instructions of the user manual. The derived plasmid vector was designated as TopoEntr-recA and has been sequenced at the core facility of the Virginia Bioinformatics Institute (Blacksburg, VA).
The PCR product was purified using the AccuPrep™ Gel Purification Kit (Bioneer, Alameda, CA) and cloned into the TopoEntr/D™ vector (Invitrogen, Carlsbad, CA) following the instructions of the user manual. The derived plasmid vector was designated as TopoEntr-recA and has been sequenced at the core facility of the Virginia Bioinformatics Institute (Blacksburg, VA).
4
Toxoplasma gondii Genotyping by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the buffy coat of each sample, using the phenol chloroform method as previously described (8 (link)). PCR was performed to amplify a 529 bp gene of T. gondii, as described by Edvinsson et al. (9 (link)), using each of two primers: TOXOF CAGGGAGGAAGACGAAAGTTG and TOXOR CAGACACAGTGCATCTGGATT. The PCR reaction mixture (25 µL) contained 1.25 units of Taq DNA polymerase, 1 μL of extracted DNA, 1.5 mM of MgCl2, 100 pmol of each primer, 0.2 mM of dNTP and a 10x PCR buffer. The PCR program consisted of one cycle of initial denaturation at 94°C for 5 minutes, 35 cycles of denaturation at 94°C for 35 seconds, annealing at 56°C for 1 minute, extension at 72°C for 1 minute, and a final extension at 72°C for 10 minutes. PCR products were separated by electrophoresis in 1.5% agarose gel and stained with ethidium bromide. The PCR product was excised from the agarose gel and purified using a DNA Gel Extraction Kit (Bioneer’s AccuPrep Gel Purification Kit, Korea), based on the manufacturer’s instructions. The purified PCR product was sequenced using the same primers used for PCR amplification. BLAST analysis was used to compare the sequences with those of available T. gondii sequences in the GenBank to discover the genotype of the parasite.
5
Sequence Variation in Mungbean Raceme Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We investigated sequence variation between VC1973A and IT208075 in genes located in the locus associated with the compound raceme to identify likely candidate genes responsible for this phenotype. The variant sequences were compared with previously reported sequences of two other mungbean lines producing compound racemes, TC1966 (wild mungbean, Vigna radiata var. sublobata) and V2984 (a Korean landrace), to identify sequence variation specific to IT208075, which has a simple raceme (NCBI accession code JJMO00000000 , Kang et al., 2014 (link)). We used Sanger sequencing to validate the sequence variation in two promising genes, VrDet1 and Vradi04g00002481. PCR products, amplified with sequence-specific primers (Supplementary Table 2 ), were purified from 1% agarose gels using the AccuPrep® Gel Purification Kit (Bioneer, Daejon, Korea), cloned into Escherichia coli using the pGEM-T Easy Vector (Promega, Madison, WI, USA), according to the manufacturer's instructions, and sequenced using an ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, CA, USA).
6
Cloning and Expression of Xylanase Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli DH5α and BL21 (DE3) strains were used as the cloning and expression hosts, respectively. Both strains were grown in Luria–Bertani broth (LB broth) at 37 °C with agitation at 180 rpm. The pET-16b (Novagen, Madison, USA) vector was used for enzyme expression and purification. Buffers and enzymes used for the polymerase chain reaction (PCR) and DNA manipulation were purchased from Takara (Takara Bio Inc., Shiga, Japan). PCR products were purified using an AccuPrep® Gel Purification Kit (Bioneer, Daejeon, South Korea), and cloned plasmids were extracted using an AccuPrep® Plasmid MiniPrep DNA Extraction Kit (Bioneer). Substrates and other reagents used for the enzyme assay, including p-nitrophenyl acetate (p-NPA), p-nitrophenol (p-NP), d -xylose, and dinitrosalicylic acid, were purchased from Sigma-Aldrich (St Louis, MO, USA). The synergistic effect was verified with commercially available endo-1,4-β-xylanase derived from Aspergillus niger (Megazyme Int., Wicklow, Ireland) using beechwood xylan (Tokyo Chemical Industry Co. Ltd., Tokyo, Japan) as the substrate.
7
Molecular Identification of Fasciola spp.
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from eggs of Fasciola collected from stool of positive cases of fascioliasis, using a DNA extraction kit (QIAamp DNA Stool Mini Kit, QIAGEN), based on manufacturer’s instructions. PCR was performed as described before (8 (link)). PCR primer sets were used for amplifying fragments of the CO1 (Mitochondrial) gene of Fasciola. PCR was done using F: Ita8 (5′-ACGTTGGATCATAAGCGTGT-3′) and R: Ita9 (5′- CCTCATCCAACATAACCTCT-3′) primers. After PCR amplification, an approximately 485 bp PCR product representing a fragment of the CO1 gene was amplified.
PCR product was excised from 1.5% agarose gel and purified with a DNA Gel Extraction Kit (Bioneer's AccuPrep Gel Purification Kit), according to the manufacturer’s instructions. Purified PCR product was sequenced, using the same primers as described for the amplification process. The sequences were aligned and compared with those of existing sequences related to Fasciola spp. available in the GenBank, using the BLAST program of GenBank.
PCR product was excised from 1.5% agarose gel and purified with a DNA Gel Extraction Kit (Bioneer's AccuPrep Gel Purification Kit), according to the manufacturer’s instructions. Purified PCR product was sequenced, using the same primers as described for the amplification process. The sequences were aligned and compared with those of existing sequences related to Fasciola spp. available in the GenBank, using the BLAST program of GenBank.
8
Cloning and Correcting Top2 Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA fragment encoding Top2 from pFlc1-Top2 (DGRC RE49802) was inserted into the pUAST-attB vector for making the pUAST-attB-Top2 construct. According to DGRC, Top2 cDNA has a deletion mutation in 304–364, point nonsense mutation; stop codon in 3802–3601. However, our analysis detected a deletion mutation at 333, and stop codon at 3817. Therefore, we corrected these mutations in pFlc1-Top2.
PCR was done using Prime star HS DNA polymerase (Takara, R010A) with primers. PCR products were separated in 1% agarose gel (Seakem LE agarose for gel electrophoresis, Lonza, 50004), purified using an Accuprep gel purification kit (Bioneer, Korea), and sequenced (Solgent, Korea).
PCR was done using Prime star HS DNA polymerase (Takara, R010A) with primers. PCR products were separated in 1% agarose gel (Seakem LE agarose for gel electrophoresis, Lonza, 50004), purified using an Accuprep gel purification kit (Bioneer, Korea), and sequenced (Solgent, Korea).
9
Cloning and Expression of ESAT-6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA encoding ESAT-6 sequence (288 bp) or EsxA or Rv3875 (GeneBank accession number BX842584) with S-tag sequence was synthesized into pGH plasmid (Bioneer, Korea) and confirmed using specific primers by PCR (94 °C for 40 sec, 57 °C for 40 sec and 72 °C for 1 min, 30 cycles). The PCR product (with S-tag) and pET22b (+) (Novagen, USA) were digested with BamHI and SalI (Fermentas, Lithuania). After gel Extraction (AccuPrep® Gel Purification Kit, Bioneer), ligation was carried out with T4 DNA Ligase (Fermentas, Lithuania) and the ligation reaction was transformed into Escherichia coli Top10 competent cell (20 (link)). The recombinant plasmids were confirmed by colony PCR, restriction enzyme analysis, and sequencing procedures.
10
Molecular Detection of Mycobacterium tuberculosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
M. tuberculosis strain H37Rv was cultured on Lowenstein Jensen (LJ) medium and was incubated for six weeks at 37°C. DNA extraction was performed using boiling method (15 ).
The mpt64 primers were designed by Gene Runner software and were synthesized by CinnaGen Company of Iran. The mpt64 gene amplification was performed using the following primers, forward:
The DNA amplification involved initial denaturation at 95°C for 4 min, proceeded by 35 cycles of denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 45 sec, followed by final extension at 72°C for seven minutes. Then, 100 μL of the PCR product was electrophoresed on 1% agarose gel and the mpt64 fragment purification was performed using AccuPrep® Gel Purification Kit (Bioneer, Korea).
The mpt64 primers were designed by Gene Runner software and were synthesized by CinnaGen Company of Iran. The mpt64 gene amplification was performed using the following primers, forward:
5′TATTTC
5′-CATATAT
The DNA amplification involved initial denaturation at 95°C for 4 min, proceeded by 35 cycles of denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 45 sec, followed by final extension at 72°C for seven minutes. Then, 100 μL of the PCR product was electrophoresed on 1% agarose gel and the mpt64 fragment purification was performed using AccuPrep® Gel Purification Kit (Bioneer, Korea).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!