The following primary and secondary antibodies were used for exosome characterization by ELISA. Mouse monoclonal antibodies anti-human CD9 (cat. 555370), CD81 (cat. 555675), CD24 (cat. 555426), Caveolin 1 (cat. 610407) and Fibronectin (cat. 610077) were purchased from BD Biosciences, USA. Mouse monoclonal antibody anti-human TSPAN8 (cat. WH0007103M2) was purchased from Sigma-Aldrich (Milano, Italy). Mouse monoclonal antibodies anti-human CD133 (cat. MAB11331), PD-L1 (cat. MAB1561), CXCR4 (cat. MAB172), EpCAM (cat. MAB9601), Integrin α6 (cat. MAB1350), Integrin β4 (cat. MAB4060), CD44s (cat. MAB7045) and CD44v6 (cat. BBA13) was purchased from R&D System, Minneapolis, USA. Mouse monoclonal antibodies anti-human CD151 (cat. 271216) and Alix (cat. 53540) were purchased from Santa Cruz Biotechnology. Rab5b polyclonal rabbit antibody anti-human (cat. HBM-RAB5-PR1, Hansa BioMed Life Sciences Ltd and cat. 598, Santa Cruz Biotechnology) was used for plate coating. Goat anti-mouse biotin conjugated antibody (cat. A16076, Thermo Fisher Scientific) was used as secondary antibody. Streptavidin Poly-HRP (cat. 21140, Thermo Fisher Scientific) is used to amplify the signal.
Anti human cd9
Manufactured by BD
Sourced in United States
Anti-human CD9 is a laboratory reagent that can be used to detect the presence of the CD9 surface protein on human cells. CD9 is a member of the tetraspanin family of proteins and is expressed on a variety of cell types, including platelets, endothelial cells, and certain immune cells. The anti-human CD9 reagent can be used in flow cytometry, immunohistochemistry, and other immunoassays to identify and characterize cells expressing CD9.
Automatically generated - may contain errors
Lab products found in correlation
Streptavidin poly hrp, by Thermo Fisher Scientific (1 mentions)
Fibronectin, by BD (1 mentions)
Caveolin 1, by BD (1 mentions)
Calretinin, by Abcam (1 mentions)
Anti mouse cd31, by BioLegend (1 mentions)
Rabbit anti vimentin mab, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Dojindo Laboratories (1 mentions)
Recombinant tgf β1, by R&D Systems (1 mentions)
Cd49d, by BioLegend (1 mentions)
2 protocols using anti human cd9
1
Exosome Characterization by ELISA
2
Immunofluorescence Analysis of miR-29b Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit mAbs to E‐cadherin, calretinin, and FN, were purchased from Abcam and Cell Signaling Technology. Recombinant TGF‐β1 was purchased from R&D Systems. Rabbit anti‐vimentin mAb and anti‐rabbit IgG conjugated with Alexa Fluor 488 or Alexa Fluor 595, anti‐mouse IgG conjugated with Alexa Fluor 647 were obtained from Invitrogen. We obtained DAPI from Dojindo. Anti‐mouse CD31, CD34, CD44, CD49d, CD73, and CD90 were obtained from BioLegend. Anti‐human CD9 and CD63 were obtained from BD Biosciences. The lentivirus plasmid of miR‐29b precursor and negative control miRNA as well as the pLV‐miRNA Expression Vector System were purchased from Biosettica. The sequence of the oligonucleotides used for miR‐29b precursor (hsa‐mir‐29b‐1) is as follows:
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG.
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!