Sensifast sybr lo rox

Manufactured by Meridian Bioscience

Sourced in United Kingdom, United States

SensiFAST SYBR Lo-Rox is a ready-to-use 2x real-time PCR mix containing SYBR Green I dye, optimized for reliable and sensitive real-time PCR with reduced ROX requirement.

Automatically generated - may contain errors

Lab products found in correlation

21 protocols using sensifast sybr lo rox

Quantifying TFF1 and TFF3 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was done for quantification of TFF1 and TFF3 gene using SensiFAST SYBR® Lo-ROX (purchased from Bioline, London, UK, catalog number: BIO-94005). For each reaction, the following was used: 10 μl of SensiFAST SYBR Lo-ROX (1X), 0.8 μl of 10 μM forward primer (400nM), 0.8 μl of 10 μM reverse primer (400nM), and 1.6 μl of template (80 ng), and each reaction was completed to reach a total volume of 20 μl by nucleases free water (6.8 μl).
Initial denaturation was done by heating for 1 min at 95°C followed by 40 cycles of denaturation at 95°C for 5 seconds and annealing /extension at 60°C for 30 seconds in 7500 Fast & 7500 Real-Time PCR System (Applied Biosystem, Themo Fisher Scientific, Life Technologies Corporation, USA). Melting curve analysis was done after amplification to confirm the specificity of the product and to exclude the presence of primer–dimers.
The relative gene expression analysis was done by Delta Delta cycle threshold (DDCT) method, and the average DCT of the healthy volunteers for each target gene was used as the calibrator sample [17 (link)]. The amount of target, normalized to an endogenous reference and relative to a calibrator, was calculated. The fold change is obtained by 2^–DDCT. This method assigns a value of 0.7 to the calibrator sample, and all other quantities are expressed as an n-fold difference relative to the calibrator.

Elnagdy M.H., Farouk O., Seleem A.K, & Nada H.A. (2018). TFF1 and TFF3 mRNAs Are Higher in Blood from Breast Cancer Patients with Metastatic Disease than Those without. Journal of Oncology, 2018, 4793498.

+ Open protocol

+ Expand

Quantifying Gene Expression in Embryonic Knee

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from embryonic knee samples using Trizol Reagent (Life Technologies, 15596-026), DNase-treated, and 500ng was then used for cDNA synthesis (SuperScript II, Invitrogen 18064-014). Quantitative RT-PCR was performed using SensiFast SYBR Lo-Rox (Bioline BIO-94005) on a Via7 (ABI) platform. Gene expression was normalized to GAPDH, and fold change was calculated using the delta-CT method (28 (link)). The following qRT-PCR primers were used: Prmt5 (F) CATGAGAGCAAGCCCACAAA, (R) CCCCACCAGCATTTTCCTAA; Bmp4 (F) ACGTACTCCCAAGCATCACC, (R) GCACAATGGCATGGTTGGTT; Gapdh (F) GGTGAAGGTCGGTGTGAACG, (R) CTCGCTCCTGGAAGATGGTG.

Ramachandran J., Liu Z., Gray R.S, & Vokes S.A. (2019). PRMT5 is necessary to form distinct cartilage identities in the knee and long bone. Developmental biology, 456(2), 154-163.

+ Open protocol

+ Expand

Quantitative PCR of Porcine Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fragments of whole skeletal muscle (30 mg) were homogenized in RNABee (AMS Biotechnology, Abingdon, UK) in Lysing Matrix D tubes (MP Biomedicals, Illkirch, France), and extracted according to manufacturer's instructions followed by transfer to a RNeasy Mini Spin column and treatment with RNase-free DNase (Qiagen, Manchester, UK). RNA was quantified using a Nanodrop ND-1000 (Labtech International Ltd., Heathfield, UK) and processed for 2-step qPCR. Complementary DNA (cDNA) was prepared from 500 ng RNA using SuperScript III reverse transcriptase (Thermo Fisher Scientific) following the manufacturer’s instructions. Quantitative PCR was then performed on a MX3005P system (Stratagene, La Jolla, CA, USA) using Sensi-FAST SYBR Lo-ROX (Bioline, London, UK), as per manufacturer instructions, and porcine-specific primers (Supplementary Table 2). A standard curve made of serial dilutions of pooled muscle cDNA was run on parallel. Test samples together with standards and no template and reverse transcriptase controls were all run in duplicate. Data were analyzed using MxPro Software. Expression levels for each sample were normalised to the average expression of the TOP2B, RPL4 and HPRT1. These three normalisers were identified based on stable expression on foetal muscle samples using geNORM V3.5 (Ghent University Hospital, Centre for Medical Genetics).

Cortes-Araya Y., Cheung S., Ho W., Stenhouse C., Ashworth C.J., Esteves C.L, & Donadeu F.X. (2024). Effects of foetal size, sex and developmental stage on adaptive transcriptional responses of skeletal muscle to intrauterine growth restriction in pigs. Scientific Reports, 14, 8500.

+ Open protocol

+ Expand

Gene Expression Analysis of Transporters in iBECs and hCMEC/D3

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene expression analysis of transporters in iBECs and hCMEC/D3, culture medium was first removed, and cells were rinsed once with D-PBS. Cells were then treated with TRIZOL ™ reagent (Thermo Fisher) and scraped off the culture plate using a pipette tip. RNA was extracted using the RNA Miniprep kit (Zymo Research) according to the manufacturer's instructions. After that, the quality and quantity of RNA was measured using a Nanodrop Spectrophotometer and RNA was converted to cDNA using SensiFAST™ cDNA synthesis kit (Bioline). 18S was used as a housekeeping gene to normalize qRT-PCR results. Following the manufacturer's instructions, cDNA samples were combined with SensiFAST™ SYBR® Lo-ROX (Bioline) and gene-specific primers to form the reaction solution. The qRT-PCR run was performed in triplicate for each sample on QuantStudio™ 5 Real-Time PCR system (Thermo Fisher Scientific). Briefly, the samples were run for 2 min at 95 °C followed by 40 cycles of 5 s at 95 °C then 30 s at 60 °C. The CT values of each gene was normalized to CT values of 18S (ΔCT values). ΔΔCt values were then calculated as 2^(−ΔCt) and multiplied by 10⁶. Multiplied ΔΔCt values were log-transformed prior to graphical presentation. Primer sequences from the genes used in this study are presented in supplementary material (Table S3).

Chaves J.C., Wasielewska J.M., Cuní-López C., Rantanen L.M., Lee S., Koistinaho J., White A.R, & Oikari L.E. (2023). Alzheimer's disease brain endothelial-like cells reveal differential drug transporter expression and modulation by potentially therapeutic focused ultrasound. Neurotherapeutics, 21(1), e00299.

+ Open protocol

+ Expand

Quantifying Mecp2 Expression in Neuronal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

6DIV WT neurons were treated with KU and homogenized prior to RNA extraction using TRIzol reagent (Invitrogen). Total RNA was isolated using the Direct-zol RNA MiniPrep isolation kit (Zymo Research) according to the manufacturer’s protocol. The RNA was eluted with 25 μL DNase/RNase-free water, quantified using NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific), and optical density 260/280 nm ratios were determined. Reverse transcription was performed using 1 μg RNA with a High Capacity cDNA RT kit (Applied Biosystems). Real-time PCR (qRT-PCR) was performed using a CFX96 thermal cycler (Bio-Rad) in a final volume of 10 μL using SYBR Green technique (SensiFAST SYBR Lo-ROX, Bioline). Mecp2 was analyzed at least in duplicate, and data analysis was performed with the ΔΔCt method and expressed as fold change. Mecp2 mRNA levels were normalized to GAPDH.

Pizzamiglio L., Focchi E., Cambria C., Ponzoni L., Ferrara S., Bifari F., Desiato G., Landsberger N., Murru L., Passafaro M., Sala M., Matteoli M., Menna E, & Antonucci F. (2021). The DNA repair protein ATM as a target in autism spectrum disorder. JCI Insight, 6(3), e133654.

+ Open protocol

+ Expand

Quantifying Gene Expression Changes in DEX-Treated Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Alteration in gene expression between naïve and DEX was analyzed by comparing expression of target genes with multiple housekeeping genes using 2^ΔΔCQ. CQ values were measured utilizing the QuantStudio5 Real‐Time PCR System (Applied Biosystems) to compare samples from the naïve and DEX animals (n = 5–8). 15 µl reaction volumes were used with cDNA (0.4 ng/µl), DEPC water, forward and reverse primers (1.2 µM/µl), and SYBR green master‐mix (SensiFAST SYBR Lo‐ROX, Bioline, Froggabio).

Lalonde C., Grandbois J., Khurana S., Murray A., Tharmalingam S, & Tai T.C. (2021). Late gestational exposure to dexamethasone and fetal programming of abnormal behavior in Wistar Kyoto rats. Brain and Behavior, 11(4), e02049.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole embryos obtained 6 h after the GD9 injection or brain cortices from mice at different developmental stages were used. Samples were homogenized in 500 μl of TRI reagent (Zymo Research) for RNA extraction. Total RNA was isolated using the Direct‐zol RNA MiniPrep isolation kit (Zymo Research) according to the manufacturer's protocol. The RNA was eluted with 25 μL DNase/RNAse‐free water, quantified using NANOdrop 2000c spectrophotometer (Thermo Fisher Scientific), and optical density 260/280 nm ratios were determined. Reverse transcription was performed using 1 μg RNA with a High‐Capacity cDNA RT kit (Applied Biosystems). Real‐time polymerase chain reaction (qRT–PCR) was performed using RT–PCR Viia7 (Applied Biosystems) in a final volume of 10 μl for SYBR Green technique (SensiFAST SYBR Lo‐ROX, Bioline) and 20 μl for TaqMan technique (Gene Expression Master Mix, Life Technologies). Each gene was analyzed at least in duplicate and data analyses were performed with the ΔΔCt method. All RNA levels were normalized to GAPDH. Primer sequences are listed in Appendix Table S2.

Rasile M., Lauranzano E., Faggiani E., Ravanelli M.M., Colombo F.S., Mirabella F., Corradini I., Malosio M.L., Borreca A., Focchi E., Pozzi D., Giorgino T., Barajon I, & Matteoli M. (2022). Maternal immune activation leads to defective brain–blood vessels and intracerebral hemorrhages in male offspring. The EMBO Journal, 41(23), e111192.

+ Open protocol

+ Expand

Gene Expression Analysis of Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression analysis was performed in cells before and after differentiation. RNA was extracted using TRIzol reagent (Invitrogen), and 500 ng were reversed transcribed with Superscript III (Invitrogen). qPCR was performed using the SensiFAST SYBR Lo-ROX (BIO-94020; Bioline) in a Stratagene thermocycler with primers listed in Table 1. Relative transcript abundance was obtained using MX3005P software by extrapolating Ct values from a standard curve prepared from a sample pool, and TOP2B and RPL4 genes were used as housekeeping gene controls. Differentiation time-point data were normalized to values from undifferentiated cells (Day 0).

Weatherall E.L., Avilkina V., Cortes-Araya Y., Dan-Jumbo S., Stenhouse C., Donadeu F.X, & Esteves C.L. (2020). Differentiation Potential of Mesenchymal Stem/Stromal Cells Is Altered by Intrauterine Growth Restriction. Frontiers in Veterinary Science, 7, 558905.

+ Open protocol

+ Expand

Validation of Monocyte DEG Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate common DEGs in ex vivo monocytes, PBMCs of HCs were separated and CD4 positive monocytic cells were sorted. Then, these cells were treated with IS for 24 hr. Total RNA of all samples was separated by using RNA purification kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) followed by cDNA synthesis (Bio-line, London, UK). Subsequently, real-time quantitative RT-PCR was performed through CFX system (Bio-Rad, Hercules, CA, USA) with SensiFAST SYBR^® Lo-ROX (Bio-line, London, UK). The primers used in this investigation were shown in Table S5. Normalization of gene expression levels was based on the expression of ACTINB. In addition, the comparative CT method (ΔΔCT) was used for quantification of gene expression.
For data analysis, two-tailed paired student’s t-test were conducted using Graph Pad Prism 8 (GraphPad Software, La Jolla, CA, USA) and Microsoft Excel 2013. p < 0.05 was considered statistically significant.

Kim H.Y., Lee S.J., Hwang Y., Lee G.H., Yoon C.E., Kim H.C., Yoo T.H, & Lee W.W. (2020). Indoxyl Sulfate-Mediated Metabolic Alteration of Transcriptome Signatures in Monocytes of Patients with End-Stage Renal Disease (ESRD). Toxins, 12(10), 621.

+ Open protocol

+ Expand

Quantifying PD-L1 mRNA Expression in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HepG2 cells at 4 × 10⁵ cells/well density were seeded in 6-well culture plates overnight and cultured in specific treatments for 6 h before being harvested for mRNA expression analysis by real-time RT-PCR. Total RNA was isolated using an illustra-RNAspin Mini RNA Isolation kit (GE Healthcare Europe GmbH, Freiburg, Germany), which was then reverse transcribed to cDNA using an iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). The mRNA expression from cDNA was then determined by RT-PCR using the Applied Biosystems 7500/7500 Fast Real-Time PCR system and SensiFAST™ SYBR^®Lo-ROX (Bioline, London, UK). The cycling conditions were 95 °C for 2 min, followed by 45 cycles of 95 °C for 5 s, 60 °C for 10 s, and 72 °C for 30 s, with a final extension at 72 °C for 10 min. The expression of each gene was normalized to that of the control gene, GAPDH, as an internal control. The relative expression level (fold-changes) of the target gene was calculated by normalizing with the corresponding control. The following primer sequences were used in these assays.
human PD-L1 forward primer5′ AAATGGAACCTGGCGAAAGC-3′human PD-L1 reverse primer5′ GATGAGCCCCTCAGGCATTT-3′human GAPDH forward primer5′TGGTATCGTGGAAGGACTCATGAC-3′human GAPDH reverse primer 5′ATGCCACTCAGCTTCCCGTTCAGC-3′

Shwe T.H., Pothacharoen P., Phitak T., Wudtiwai B, & Kongtawelert P. (2021). Atorvastatin Attenuates Programmed Death Ligand-1 (PD-L1) Induction in Human Hepatocellular Carcinoma Cells. International Journal of Molecular Sciences, 22(16), 8755.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!