IFNAR1 was knocked out from a cell line derived from a spontaneous KEP mammary tumor by transient transfection with a lentiCRISPRv262 (link) containing IFNAR1-specific sgRNA targeting exon 1 (sgRNA1: 5’- GCTCGCTGTCGTGGGCGCGG - 3’). 24 h after transfection, cells were exposed to puromycin for 48 hours. Cells were stained with IFNAR1-PE (1:200, clone MAR1-5A3, eBioscience) and IFNAR1 negative cells were sorted with BD FACSARIA FUSION sorter with DIVA software (BD Biosciences).
250 KEP and IFNAR1 KO KEP cells were seeded in triplicate in a 24 well plate and the next day cells were treated with an increasing concentration of recombinant IFNα1 (Biolegend) for 7 days. On day 5, 4μM or 8 μM of cisplatin was added. At day 7, cells were washed, fixed in ice-cold methanol and incubated with 0.05% crystal violet. For quantification, crystal violet was dissolved in 10% acetic acid for 20 min and the absorbance was measured at 590nm.
250 KEP and IFNAR1 KO KEP cells were seeded in triplicate in a 24 well plate and the next day cells were treated with an increasing concentration of recombinant IFNα1 (Biolegend) for 7 days. On day 5, 4μM or 8 μM of cisplatin was added. At day 7, cells were washed, fixed in ice-cold methanol and incubated with 0.05% crystal violet. For quantification, crystal violet was dissolved in 10% acetic acid for 20 min and the absorbance was measured at 590nm.