Genomic DNA was extracted from 1–2 million cells using High Pure PCR Template Preparation Kit (Roche) according to the manufacturer’s instructions. Sox1 PCR was performed using primers F: 5’-CCCTTCTCTCCGCTAGGC-3’ and R: 5’-GTTGTGCATCTTGGGGTTTT-3’ . Sox3 PCR used primers F: 5’-CAGCATGTACCTGCCACCT-3’ and R: 5’-ACAAAACCCCGACAGTTACG-3’ . RFLP or T7E1 assay was performed by mixing 5 μL of PCR products (without purification) with the restriction enzymes or T7E1 enzyme (NEB) in a total volume of 20 μL and incubated for 1 hour at the suggested optimal temperatures. Prior to T7E1 assay, PCR products were slowly re-annealed to form heteroduplex products by heating the PCR products at 95°C for 5 minutes and slowly ramped down to room temperature.
T7e1 enzyme
Manufactured by New England Biolabs
Sourced in United States, China
The T7E1 enzyme is a DNA endonuclease that recognizes and cleaves heteroduplex DNA. It is commonly used to detect the presence of single nucleotide polymorphisms (SNPs) or small insertions/deletions (indels) in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Nebuffer 2, by New England Biolabs (5 mentions)
Quickextract dna extraction solution, by Illumina (3 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (2 mentions)
Dna clean and concentrator 5 kit, by Zymo Research (2 mentions)
Pcr purification kit, by Qiagen (2 mentions)
Taq polymerase, by New England Biolabs (2 mentions)
Crispr cas9 protein, by GenScript (2 mentions)
Lipofectamine cmax transfection reagent, by Thermo Fisher Scientific (2 mentions)
Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (2 mentions)
High pure pcr template preparation kit, by Roche (1 mentions)
Primestar max dna polymerase, by Takara Bio (1 mentions)
Fastpure gel dna extraction mini kit, by Vazyme (1 mentions)
Phusion flash high fidelity pcr master mix, by Thermo Fisher Scientific (1 mentions)
Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity pcr master mix, by Thermo Fisher Scientific (1 mentions)
Gel pro software, by Media Cybernetics (1 mentions)
G box, by Syngene (1 mentions)
38 protocols using t7e1 enzyme
1
Genomic DNA Extraction and Gene-Specific PCR Analysis
2
Cassava Genome Editing Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cassava genomic DNA was extracted using the Plant Genomic DNA Kit (Tiangen, China). The T7EI assay performed according to the previously described protocols [14 (link), 67 (link)]. Briefly, a 504-bp fragment of MePDS (Manes.05G193700.1) containing the target sites was amplified from genomic DNA (gDNA) using PrimeSTAR Max DNA Polymerase (Takara) and the MePDSF2/R2 primer pair [42 (link)]. The PCR products were purified from agarose gels using the FastPure Gel DNA Extraction Mini Kit (Vazyme). The purified PCR products (200 ng) were then denatured and reannealed in NEBuffer 2 (NEB) to generate heteroduplex DNA under the following reaction conditions: 95°C for 10 min, 85°C for 2 min, 75–25°C (with 10°C increments over 3 min), and 4°C for 10 min. The heteroduplex DNA was then incubated with 10 U of T7E1 enzyme (NEB) at 37°C for 1 h. The products of the T7EI reaction were analyzed by 2% agarose gel electrophoresis. Mutation rates were determined using Image J software (http://imagej.nih.gov/ij/ ) following previously described methods [68 ]. In addition, the purified PCR products were cloned into the pCE2 TA/Blunt-Zero vector using the TOPO cloning kit (Vazyme), and the mutations in the positive clones were identified through Sanger sequencing.
3
T7E1 Assay for DNA Mutation Detection
4
Quantifying CRISPR Editing Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Editing efficiency was estimated by T7 endonuclease I assay. Genomic DNA was extracted from control and edited cells using the spin tissue isolation kit (Invisorb). Target regions were PCR-amplified with the Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific) according to the manufacturer protocol. PCR products were denatured at 95°C for 5 min and reannealed at −2°C/s temperature ramp to 85°C, followed by a −0.1°C/s ramp to 25°C. The heterocomplexed PCR product (200 ng) was incubated with 5 U of T7E1 enzyme (New England Biolabs) and buffer 2 at 37°C for 30 min. Products from mismatch assays were electrophoresed on 2% agarose gel. The percentage of editing was analyzed by Sanger sequencing and calculated using the ICE (inference of CRISPR edits) webtool provided by Synthego.
5
T7E1 Assay for Nuclease Target Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A T7E1 assay was conducted following a previously described protocol 23 (link). We isolated genomic DNA (Promega, WI, USA) from the collected samples following the manufacturer's instructions. A polymerase chain reaction (PCR) were used to amplify the region containing the nuclease target site using the following hemi-nested primers. USP32 first PCR: forward 5′ AGATGGAAGTGGAGTTTCTGGA 3′ and reverse 5′ GTCACAGATGGCTCAAGGCTA 3′; USP32 second PCR: 5ʹ AGATGGAAGTGGAGTTTCTGGA 3′ and reverse 5′ ACATGAGCACTGTTTCAGGTTC 3′. The PCR amplicons were denatured at 95 °C and annealed to form heteroduplex DNA and treated with 5 units of T7E1 enzyme (New England Biolabs, MA, USA) at 37 °C for 20 min. Gel electrophoresis was performed using 2% agarose to separate cleaved regions. ImageJ was used to quantify the mutation frequencies using the following equation: mutation frequency (%) = 100 × (1 - [1 - fraction cleaved]1/2), where the fraction cleaved was the total relative density of the cleavage bands divided by the sum of the relative density of cleavage and uncut bands. Potential off-target sites were selected from CRISPOR 24 (link) and validated using a T7E1 assay.
6
CRISPR-Cas9 Mediated Genome Editing in Zebrafish
7
T7E1 Mismatch Assay for Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the T7E1 mismatch assay, genomic DNA was amplified using Phusion High-Fidelity PCR Master Mix (Thermo Fisher Scientific) with primers (MK024 and MK025) as described in the paper by Ramlee et al (30 (link)). The PCR amplification conditions were as follows: initial denaturation for 3 min at 95°C; 30 cycles of 95°C for 30 s, 63°C for 30 s, and 72°C for 30 s; and a final elongation at 72°C for 5 min. PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific). Next, 400 ng of purified PCR product was used in an annealing reaction and enzymatic digestion by the T7E1 enzyme (New England Biolabs, Ipswich, MA, USA). The DNA fragments were separated on a 1.3% agarose gel and visualized by EB staining. The DNA band intensity was quantified using G:BOX (Syngene, Cambridge, UK) and analyzed with GelPro software (Media Cybernetics, Rockville, MD, USA). The INDEL frequency was estimated by comparing the digested band intensities to all bands.
8
Targeted Mutagenesis Detection in Potato
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One week after transfection, targeted mutagenesis in potato protoplasts was detected by the T7E1 assay. Total genomic DNA was isolated from the protoplast population or calli using the HiYield Genomic DNA Mini Kit (Real Biotech Corporation, Taiwan), according to the manufacturer’s instructions. Then, the target StSR4 site (289 bp) was amplified from the genomic DNA using StSR4_F1 (446) and StSR4_R-T7 primers (Table S1
9
T7E1 Indel Detection in Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T7 endonuclease I (T7E1) assays were performed to assess indel efficiency by AsCpf1, LbCpf1, or SpCas9 at targeted loci in HEK-293T cells. PCR products were obtained by PCR amplifications of targeted loci using a SolgTM Pfu-based PCR Amplification Kit (SolGent). PCR products (100–300 μg) were incubated with 10 U of T7E1 enzyme (New England Biolabs) in 25 μl of reaction mixture at 37 °C for 1 h. Twenty microliters of reaction mixtures were directly loaded onto 10% SDS-PAGE gels, and digested products were resolved run in a Tris/Borate/EDTA buffer system. After staining in ethidium bromide solutions, gels were digitalized in a Printgraph 2M Gel Imaging System (Atto). Digitalized images were analyzed to calculate indel efficiency using the Image J software.
10
Validating CRISPR Edits in Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify editing in clones, in which an intronic enhancer of TBC1D4 was targeted, genomic DNA was isolated from transfected and control cell pellets using QuickExtract DNA Extraction Solution (Epicenter) according to manufacturer’s instructions. DNA was then concentrated by ethanol precipitation. The 1 kb region containing the gRNA targeted region was amplified with forward and reverse primers (Table 1 ) using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB) according to the manufacturer’s protocol with 100 ng of the purified total cellular DNA in a 50 μl reaction. Amplification products were isolated using the DNA Clean and Concentrator-5 kit (Zymo Research). PCR product (50 ng) was denatured and re-annealed in a final volume of 13 μl in 1× NEBuffer2 (NEB) using a thermocycler with the following protocol: 95 °C, 5 min; 95→85 °C at −2 °C/s; 85→25 °C at −0.1 °C/s; hold at 4 °C. Hybridized PCR products were treated with 10 U of T7E1 enzyme (NEB) at 37 °C for 60 min in a reaction volume of 20 µL. The reaction was stopped with 2 µL of 0.25 M EDTA, and subsequently analyzed on a 1.5% agarose gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!