The presence of the plasmid was investigated on the C. abortus-positive samples by a conventional PCR, using the in-house primer set (pCpsi_Fw 5′-AGCTGTGCATACATGGCTGT-3′ and pCpsi_Rv 5′-CAGTAACTGCGGTAGCTCGT-3′), targeting a 734-nucleotide region within the chlamydial plasmid tyrosine recombinase XerC gene harboured by the plasmid II of C. abortus strain 15-58d44 (GenBank Accession Number OU508368.1). DNA amplification was performed in a final volume of 25 µL containing 2 µL of DNA samples, 1× PCR reaction buffer, 1 U of Hot start Taq DNA polymerase (Qiagen, 40724 Hilden, Germany), 200 µM of each deoxynucleotide triphosphate (Promega, 20126 Milan, Italy) and 0.4 mM of each forward and reverse primers. The following cycling parameters were used: initial denaturation at 94 °C for 10 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 60 s, final extension at 72 °C for 7 min. DNA amplified fragments were sequenced by the Sanger method by Eurofins Genomics (85560 Ebersgerg, Germany) using the same primers. Nucleotide sequences of the plasmid DNA fragments were aligned and analysed in MEGA7 [34 (link)]. Phylogenetic trees were constructed by using the maximum likelihood method based on the general time-reversible model. Bootstrap tests were for 1000 repetitions.
Deoxynucleotide triphosphate
Manufactured by Promega
Sourced in United States
Deoxynucleotide triphosphates (dNTPs) are the building blocks of DNA. They are essential for the synthesis of DNA during various molecular biology techniques, such as PCR, DNA sequencing, and DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Mgcl2, by Promega (3 mentions)
Rnase inhibitor, by Promega (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Gotaq g2 hot start polymerase, by Promega (2 mentions)
Mgso4, by Merck Group (2 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (2 mentions)
Random primer, by Promega (2 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Rnase microkit, by Qiagen (2 mentions)
Hotstart taq dna polymerase, by Qiagen (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 1000 uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Sybr green pcr master mix, by Toyobo (1 mentions)
Amv reverse transcriptase, by Promega (1 mentions)
Hotstartaq dna polymerase, by Qiagen (1 mentions)
Bovine serum albumin (bsa), by New England Biolabs (1 mentions)
Pcr buffer, by Qiagen (1 mentions)
Imagequannt software, by Cytiva (1 mentions)
13 protocols using deoxynucleotide triphosphate
1
Plasmid Detection in C. abortus
2
Quantification of SIRT1 and SIRT3 mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA was extracted from hypothalamic and hepatic tissue samples by using TRIzol (1 mL/100 mg tissue; Invitrogen, Carlsbad, CA, USA). RNA purity was assessed using a NanoDrop ND-1000 UV-Vis spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Two micrograms of total RNA were added to each complementary DNA (cDNA) synthesis reaction. RNA was reverse-transcribed into cDNA for 30 minutes at 37°C in a reaction mixture containing 200 U of moloney-murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) and oligo-dT primers, 25 U RNase inhibitor (Promega), 0.5 mM deoxynucleotide triphosphate (Promega), 2 μM random hexamer primers. Amplification reaction was performed using prepared cDNA. The following primers were used (Table 1 ). The mRNA levels of SIRT1 and SIRT3 expressions were determined by normalizing to glyceraldehyde 3-phosphate dehydrogenase expressions.
3
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. For RT-qPCR, 5 µg total RNA was reverse transcribed for 30 min at 37°C in a reaction mixture containing the RNA, 40 U RNase inhibitor (Promega Corporation), 0.5 mM deoxynucleotide triphosphate (Promega Corporation), 2 µM random hexamer primers, 5X AMV reverse transcriptase reaction buffer and 30 U AMV reverse transcriptase (Promega Corporation). RT-qPCR analysis was performed using the SYBR Green PCR Master Mix (Toyobo Life Science) and RT-qPCR thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by amplification for 45 cycles performed at 95°C for 5 sec, 60°C for 10 sec and 72°C for 15 sec, 95°C for 10 sec and 10 sec each at 0.2°C increments to 62°C for a melting curve analysis, and 65°C for 1 min, followed by cooling to 37°C for 10 min with gene-specific primers. The relative expression of each gene was normalized against β-actin. The samples were assayed on a LightCycler 480 (Roche Diagnostics) instrument and the concentration was calculated as copies per µl using the standard curve. Primer sequences (Macrogen, Inc.) are listed in Table I .
4
Multiplex PCR for Staphylococcus aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five µL of S. aureus DNA were employed in the multiplex PCR protocol described by Oliveira and de Lencastre [30 (link)] for the detection of the mecA gene and the characterization of the SCCmec as well. The resulting amplicons were separated, loading 2 µL of the reaction mixture on agarose gel (2% w/v) and performing electrophoresis in TAE buffer at 100 V for 1 h 50 min. The tst gene was detected as described by Johnson et al. [100 (link)] with minor modifications in the reaction mixture that was prepared as follows: 3 µL of the extracted DNA, 0.4 µM of each primer, 2.5 mM of MgCl2 (Promega, Madison, WI, USA), 0.25 mM of each deoxynucleotide triphosphate (Promega, Madison, WI, USA), 1 U of GoTaq G2 hot start polymerase (Promega, Madison, WI, USA), 1X reaction buffer (Promega, Madison, WI, USA), and nucelase-free water to a final volume of 25 µL. Amplicons were separated by electrophoresis in TAE buffer at 100 V on agarose gel (1.3% w/v). S. aureus strains used as controls in the PCR assays are reported in Table S1 [13 (link),50 (link),93 (link),94 (link),95 (link),96 (link),97 (link)].
5
Quantifying Alu Methylation via COBRA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To observe methylation levels of Alu in samples, the sodium-bisulfite-treated DNA in each sample was amplified by PCR containing 1x PCR buffer (Qiagen, Germany), 0.2 mM of deoxynucleotide triphosphate (Promega, USA), 1 mM of magnesium chloride (Qiagen, Germany), 25 U of HotStarTaq DNA Polymerase (Qiagen, Germany), and 0.3 μM primer pairs: ALU-BRev (5′-CTAACTTTTTATATTTTTAATAAAAACRAAATTTCAC CA-3′) where R = A and G and Y = C and T. For Alu amplification, the program was set as follows: 95 °C for 15 min, 40 cycles of 95 °C for 45 s, 57 °C for 45 s, and 72 °C for 45 s, followed by a final extension of 72 °C for 7 min [20 (link)]. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA). The band intensity of Alu methylation was observed and measured by typhoon fla 7000 and ImageQuanNT Software (Amersham biosciences, UK) (Additional file 1 : Figure S1) [11 ].
6
PCR Amplification and Cloning of C. glutamicum DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oligonucleotides described in Table 3 were used as primers. PCR was carried out with 2.5 U thermostable DNA polymerase (AmpliTaqGold from Perkin-Elmer, Waltham, MA, USA) in a reaction mixture containing 10-100 ng genomic C. glutamicum DNA, 0.2 mM of each deoxynucleotide triphosphate (Promega), 0.5 mM of each primer, 2 mM MgCl 2 , and 1x AmpliTaq Buffer in a final volume of 50 mL. For the amplification reaction, after 10 min at 94°C, 25 cycles (1 min of denaturation at 94°C, 1 min of hybridization at 50°C, 1 min of elongation at 72°C) were run, followed by a final elongation step of 5 min at 72°C. PCR experiments were carried out using the Crocodile II (Appligène, Cedex, France). The amplified Genetics and Molecular Research 14 (1): 2104-2117 (2015) H.M. El Shafey and S. Ghanem DNA fragment of the expected size was cloned into the pGEM-T vector (Promega).
7
DNA Genotyping via PCR-RFLP Technique
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA samples were obtained from 400 μL peripheral blood, using Wizard Genomic DNA Purification Commercial Kit (Promega Corporation, Fitchburg, WI, USA). Genotyping was based on polymerase chain reaction (PCR)-restriction fragment length polymorphism technique. For specific DNA amplification, a total amount of 100 ng of genomic purified DNA was amplified in a volume of 25 μL reaction mixture containing 12.5 μL of PCR mastermix, a premixed, ready-to-use solution containing Taq DNA polymerase, deoxynucleotide triphosphates, MgCl2, and reaction buffers (Promega Corporation); 7.5 μL free nuclease water; 1 μL of bovine serum albumine; 1 μL of each primer; and 1 μL of water suspended DNA. The amplification products were submitted to enzyme digestion (Fermentas; Thermo Fisher Scientific, Waltham, MA, USA) and analyzed by electrophoresis agarose gel (MetaPhor®; FMC BioProducts, Rockland, ME, USA), allowing detection by ethidium bromide staining of the corresponding genotypes. Specific thermocycling conditions and resulting DNA fragments are presented in Table 1 . The genotypic analyses of NOS2A −954G/C (rs2297518) and VEGF +936C/T (rs3025039) were done in accordance with the studies of Kun et al22 (link) and Guan X et al.23 (link)
8
LAMP Assay for Rapid Pathogen Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LAMP assays were conducted as previously described [19 (link)] with some modifications. Briefly, each reaction was performed in a total of 25 μl mixture containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of the primers LF and LB (Eurofins MWG Operon, Louisville, KY), 1.2 mM deoxynucleotide triphosphates (Promega, Madison, WI), 6mM MgSO4 (Sigma-Aldrich, St. Louis, MO), 1 M betaine (MP Biomedicals, Solon, OH), 1x thermopol buffer (New England BioLabs, Ipseich, MA), 8 U Bst DNA polymerase (New England BioLabs, Ipseich, MA), sterile PCR grade water (Promega, Madison, WI), and 2 μl of DNA template. The reaction was amplified for 45 minutes at 65°C and was terminated by heating at 80°C for 2 minutes. After the amplification, 1 μl SYBR Green I (Lonza, Allendale, NJ) was added to each LAMP reaction tube to observe the color change. Since fluorescent dye SYBR Green I binds to double-stranded DNA and produces a yellow fluorescence which can be observed by the naked eye under natural light or under UV lamp. The observation of the yellow/fluorescence color change indicates a positive reaction.
9
Isothermal DNA Amplification Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Betaine, calcein, KCl, MgSO4, MnCl2, (NH4)2SO4, and Triton X-100 were purchased from MilliporeSigma (St. Louis, MO). Bst 2.0 WarmStart DNA polymerase was purchased from New England Biolabs (Beverly, MA), deoxynucleotide triphosphates from Promega (Madison, WI), Tris (pH 7.5) from Invitrogen (Carlsbad, CA), Nuclease-free water, DMSO, NaOH, and polysorbate 20 from ThermoFisher (Waltham, MA). Tris (pH 8.8) was purchased from VWR (Radnor, PA), and PCR tubes with optically clear lid strips from Bio-Rad (Hercules, CA). Primers were purchased from Integrated DNA Technologies (Coralville, IA).
10
Chronic Pain Regulation Mechanism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals were terminally anaesthetised with an overdose of isoflourane and the ipsilateral lumbar dorsal horn and L3-L5 DRGs were dissected (EP n = 4, EPS n = 4, LP n = 4, LPS n = 4), snap frozen in liquid nitrogen and stored at −80°C. RNA was extracted from homogenized tissue using a RNAse microkit (Qiagen). First strand cDNA synthesis was performed on 500 ng RNA using a Superscript III Reverse Transcriptase kit (Invitrogen) according to manufacturers instructions with deoxynucleotide-triphosphates (Promega), and random primers (Promega). mRNA levels of IL-1β, TNFα, IL-6, ATF-3, Iba1, and glial fibrillary acid protein (GFAP) were measured with quantitative PCR using specific primers (Table II ) and LightCycler® 480 SYBR Green I master mix (Roche). The mRNA levels were normalized to GAPDH and expressed as either 2-ΛCT values or relative to sham groups.Table II
Primer sequences
| Gene | Forward sequence (5‘-3’) | Reverse sequence (5‘-3’) | Source |
|---|---|---|---|
| IL-1β | AGGAGAGACAAGCAACGACA | TTTGGGATCCACACTCTCCAG | Invitrogen |
| Iba1 | TCCCCACCTAAGGCCACCAGC | CGTCTCCTCGGACCACTGGA | Sigma |
| ATF-3 | GGTCGCACTGACTTCTGAGG | CTCTGGCCGCTCTCTGGA | Sigma |
| TNFα | CGTCGTAGCAAACCACCAAGC | ATGGCGGAGAGGAGGCTGACT | Sigma |
| IL-6 | TCTCTCCGCAAGAGACTTCC | CCGGACTTGTGAAGTAGGGA | Sigma |
| GFAP | CAACCTCCAGATCCGAGAA | TCTTGAGGTGGCCTTCTGAC | Sigma |
| GAPDH | CTGCACCACCAACTGCTTAG | TGATGGCATGGACTGTGG | Sigma |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!