The largest database of trusted experimental protocols

Sybra green pcr master mix

Manufactured by Takara Bio
Sourced in Japan

SYBR Green PCR Master Mix is a ready-to-use solution containing all the necessary components for real-time quantitative PCR (qPCR) amplification, including DNA polymerase, dNTPs, buffer, and SYBR Green I dye.

Automatically generated - may contain errors

3 protocols using sybra green pcr master mix

1

Quantitative Analysis of miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol reagent (Thermo Fisher Scientific) was used to extract cell RNA. Hairpin-it miRNAs qRT-PCR kit (GenePharm) and PrimeScript RT Master Mix (Takara, China) were utilized for cDNA synthesis from miRNA and mRNA. SYBRA Green PCR Master Mix (Takara, Japan) was utilized for miRNA and mRNA expression detection. qPCR analysis was conducted on QuantStudio 3 (Thermo Fisher Scientific) PCR system per specifications (for primers, see Table 1). U6 and β-actin were taken as endogenous references for miR-654-3p and CREB1/PSEN1, respectively.
+ Open protocol
+ Expand
2

qRT-PCR Protocol for miR-30c-2-3p and ARHGAP11A

Check if the same lab product or an alternative is used in the 5 most similar protocols
qRT-PCR was conducted as described earlier [1 (link)]. Total RNA in cells was isolated by Trizol reagent (Thermo Fisher Scientific, USA) and treated with DNAse. Thereafter, cDNA was extracted applying High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA). qPCR was conducted by a PCR amplifier of SYBRA Green PCR Master Mix (Takara, Japan) in QuantStudio 3 (Thermo Fisher Scientific, USA) (primers are displayed in Table 1). U6 and GAPDH were the internal references for miR-30c-2-3p and ARHGAP11A, respectively.

Primers of qRT-PCR.

GenePrimer sequence (5’→ 3’)
miR-30c-2-3pF:TCCTTTTACAGTTGACCTCAGAAAC
R:GGCGAATATTTTGAAACCCTTTTGG
ARHGAP11AF:GCCAAGCTCGGAAAAGAACG
R:GCATCGACAAGAAAGCTTGGAA
U6F:CTCGCTTCGGCAGCACA
R:AACGCTTCACGAATTTGCGT
GAPDHF:GAACGGGAAGCTCACTGG
R:GCCTGCTTCACCACCTTCT
+ Open protocol
+ Expand
3

Quantitative Analysis of Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA in cells was extracted by Trizol Reagent (Thermo Fisher Scienti c, USA). The extracted RNA was reversely transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scienti c, USA). According to instructions of the kit, qPCR analysis was done with SYBRA Green PCR Master Mix (Takara, Japan) in QuantStudio 3 (Thermo Fisher Scienti c, USA) qPCR instrument (primers: see Table 1). GAPDH was utilized as an internal reference gene for CDK1 expression, and U6 for miR-195-5p. RIPA lysis buffer was used to treat cells and isolate intracellular proteins. SDS-polyacrylamide gel electrophoresis was performed on the same amount of protein samples. Then, the proteins were blotted onto the PVDF membrane and sealed with 5% skim milk at room temperature for 1 h. Finally, membrane was co-incubated with primary antibody at 4 ℃ overnight. Antibodies were purchased from Abcam (UK): anti-CDK1 antibody (ab32094), anti-RPA32 antibody (ab109084), anti-p-RPA32 antibody (ab109394), and GAPDH antibody (ab181602). After the primary antibody was washed, membrane was cultured with the secondary antibody IgG H&L (HRP, ab6721) for 1 h at room temperature. Imaging was developed and photographed on ChemiDoc™ Touch Imaging System (Bio-RAD US) using a hypersensitive ECL kit, and nally analyzed using ImageJ.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!