Hoechst 33342, Protein A/G agarose and a NuPAGE system were purchased from Invitrogen Life Technologies (Grand Island, NY, USA). AbuRPFK(5-Fam)-NH2 peptide was obtained from Biomer Technologies (Pleasanton, CA, USA). Anti-cIAP1 antibody for western blot analysis was purchased from R&D Systems (Minneapolis, MN, USA). Anti-GAPDH, anti-caspase-8 and anti-PARP antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-RIPK1 antibody was obtained from BD Biosciences (Franklin Lakes, NJ, USA). Anti-TRAF2 antibody was obtained from Cell Signaling (Danvers, MA, USA). IAP antagonists were synthesized at TetraLogic Pharmaceuticals.
Anti parp antibody
Manufactured by Santa Cruz Biotechnology
Sourced in United States
The Anti-PARP antibody is a laboratory reagent used for the detection and analysis of the PARP (Poly(ADP-ribose) Polymerase) protein. PARP is an enzyme involved in various cellular processes, including DNA repair. This antibody can be used in techniques such as Western blotting, immunoprecipitation, and immunocytochemistry to identify and study the PARP protein.
Automatically generated - may contain errors
Lab products found in correlation
Anti nitrotyrosine antibody, by Merck Group (3 mentions)
Dm6 microscope, by Leica (2 mentions)
Anti histone h3 antibody, by Abcam (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (1 mentions)
Protein a g agarose, by Thermo Fisher Scientific (1 mentions)
Nupage system, by Thermo Fisher Scientific (1 mentions)
Anti gapdh, by Santa Cruz Biotechnology (1 mentions)
Anti caspase 8, by Santa Cruz Biotechnology (1 mentions)
Anti ripk1 antibody, by BD (1 mentions)
Anti traf2 antibody, by Cell Signaling Technology (1 mentions)
Ex 527, by Merck Group (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Streptomycin, by Merck Group (1 mentions)
Penicillin, by Merck Group (1 mentions)
Hemin, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Harvard Bioscience (1 mentions)
Anti hsp27, by Santa Cruz Biotechnology (1 mentions)
Anti caspase 3, by Santa Cruz Biotechnology (1 mentions)
Anti p selectin antibody, by Santa Cruz Biotechnology (1 mentions)
Anti icam 1 antibody, by Santa Cruz Biotechnology (1 mentions)
9 protocols using anti parp antibody
1
Analyzing Apoptosis Signaling Pathways
2
Sirtuin Modulation in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture and reagents. HeLa cells were cultured in Minimal Essential Medium (MEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% FBS (Biochrom AG, Berlin, Germany), 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich) and maintained in 5% CO 2 at 37˚C. EX527, AGK2 and hemin were purchased from Sigma-Aldrich. Fugene HD transfection reagent was from Promega (Madison, WI, USA). Polyclonal anti-HSF1, anti-HSP27, anti-caspase-3, and anti-PARP antibodies were from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Monoclonal anti-Sirt1 and anti-Sirt2 antibodies were from Cell Signaling Technology (Danvers, MA, USA).
Reverse transcription-polymerase chain reaction. Total RNA of HeLa cells was extracted using TRIzol reagent (Life
Reverse transcription-polymerase chain reaction. Total RNA of HeLa cells was extracted using TRIzol reagent (Life
3
Immunohistochemical Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemical analysis was performed as already described [56 (link)]. The sections were incubated overnight with primary antibodies, i.e., anti-P-selectin antibody (Santa Cruz Biotechnology), anti-ICAM−1 antibody (Santa Cruz Biotechnology), antinitrotyrosine antibody (Millipore), and anti-PARP antibody (Santa Cruz Biotechnology). All sections were washed with PBS and then treated as previously reported [61 (link)]. Stained sections from each mouse were scored in a blinded fashion and observed using a Leica DM6 microscope (Leica Microsystems SpA, Milan, Italy) following a typical procedure [22 (link)]. The histogram profile is related to the positive pixel intensity value obtained [15 (link)]. All images were acquired at 10 × magnification (250 µm).
4
PARP Immunohistochemistry in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung sections were incubated with anti-PARP antibody (1:250, Santa Cruz Biotechnology), as previously described by Cordaro et al. [50 (link),51 (link)]. At the end of the protocol, the digital photos were analyzed by two observers blinded to the treatment, as previously performed in our laboratory [46 (link),52 (link),53 (link)].
5
Cell Viability and Apoptosis Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture media such as DMEM/F12, Leibovitz's (L-15), Eagle's Minimum Essential Medium (EMEM), Sodium pyruvate, Fatal Bovine Serum (FBS), Dimethyl sulfoxide (DMSO), 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyl tetrazolium bromide (MTT), Propidium iodide (PI), 2`7`-2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA), Annexin FITC/PI kit, RNase A, Hoechst 33258, were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Seablue Protein Ladder was obtained from Thermo Fisher Pvt. Ltd. Anti caspase-3 (cleaved) and anti caspase-9 (cleaved) were obtained from Cell Signaling Technology, β-Actin antibody and anti PARP antibody purchased from Santa Cruz Biotechnology. All other chemicals and reagents were of AR grade and were purchased from commercial sources.
6
Immunohistochemical Analysis of Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemical analysis was performed as already described [50 (link)]. Tissues were fixed in 10% (w/v) PBS-buffered formaldehyde and 7 μm sections were prepared from paraffin embedded tissues. After deparaffinization, endogenous peroxidase was quenched with 0.3% (v/v) hydrogen peroxide in 60% (v/v) methanol for 30 min. The sections were permeabilized with 0.1% (w/v) Triton X-100 in PBS for 20 min. Non-specific adsorption was minimized by incubating the section in 2% (v/v) normal goat serum in PBS for 20 min. Endogenous biotin and avidin binding sites were blocked by sequential incubation for 15 min with biotin and avidin (DBA, Milan, Italy). Subsequently, the sections were incubated overnight with: anti-nitrotyrosine antibody (1:100; Millipore, Abingdon, UK) or anti-PARP antibody (1:100; Santa Cruz Biotechnology). Sections were washed with PBS and incubated with peroxidase-conjugated bovine anti-mouse IgG, secondary antibody (1:2000 Jackson Immuno Research, WestGrove, Pennsylvania, USA). Specific labeling was provided with a biotin-conjugated goat anti-mouse IgG and avidin-biotin peroxidase complex (Vector Laboratories, Burlingame, California, USA). Images were collected using a Leica DM6 (Milan, Italy) microscope. The percentage area of immunoreactivity (described by the number of positive pixels) was reported as percent of total tissue area (red staining).
7
Immunohistochemical Profiling of Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemical analysis was performed as already described [49 (link)]. The sections were incubated overnight with primary antibodies: anti-TGF-β antibody (1:250, Santa Cruz Biotechnology), anti-(α-sma antibody (1:250, Santa Cruz Biotechnology), anti-nitrotyrosine antibody (1:500, Millipore), anti-PARP antibody (1:250, Santa Cruz Biotechnology), anti-CD4 (1:250, Santa Cruz Biotechnology) and anti-CD8 (1:250, Santa Cruz Biotecnology). All sections were washed with PBS and then treated as previously reported [50 (link)]. Stained sections from each mouse were scored in a blinded fashion and observed using a Leica DM6 microscope (Leica Microsystems SpA) following a typical procedure [51 (link)]. The histogram profile is related to the positive pixel intensity value obtained [52 (link)]. The number of positive cells was counted in three sections per animal and presented as the number of positive cells per high-power field.
8
Chromatin-bound PARP1 Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin‐bound fraction samples were prepared as described previously (Ooka et al., 2018 (link)). Briefly, we harvested 5 × 106 TK6 or MCF‐7 cells and isolated the chromatin‐bound fraction from TK6 cells using a subcellular protein fractionation kit for cultured cells (Thermo Fisher Scientific). PARP1 was detected using an anti‐PARP antibody (Santa Cruz Biotechnology, sc‐8007). Histone was probed as a loading control using an anti‐histone H3 antibody (Abcam, ab1791).
9
Generation and Validation of PARP1 KO
Check if the same lab product or an alternative is used in the 5 most similar protocols
PARP1 was disrupted with KO constructs prepared using primers 5′‐GCGAATTGGGTACCGGGCCTGGGGAGTAGTGCTTTGTTT‐3′ and 5′‐CTGGGCTCGAGGGGGGGCCCTGGAGAATCAAACAGACAG‐3′ for the left arm and 5′‐TGGGAAGCTTGTCGACTTAAGTAAGATCTTGGGGGCCCAG‐3′ and 5′‐CACTAGTAGGCGCGCCTTAACTTAAATTCCAAATGGCTGG‐3′ for the right arm. The PCR‐amplified left and right arms were inserted in marker‐gene plasmids (above described DT‐ApA/NEOR‐based plasmids) digested with ApaI and AflII using the GeneArt Seamless Cloning & Gibson Assembly system (Thermo Fisher Scientific, Pittsburgh, PA) to KO construct. The resultant KO plasmids express diphtheria toxin from outside of the homologous arms to suppress random integration events. The CRISPR expression vector for the CRISPR‐Cas9 system was designed to recognize 5′‐GAAGTACGTGCAAGGGGTGTATGG‐3′ (Figure S1). The loss of the PARP1 expression was confirmed by western blot using antibodies, anti‐PARP antibody (Santa Cruz Biotechnology, sc‐8007), and anti‐histone H3 antibody (Abcam, ab1791) for the loading control.
+ Expand
PARP1 was disrupted with KO constructs prepared using primers 5′‐GCGAATTGGGTACCGGGCCTGGGGAGTAGTGCTTTGTTT‐3′ and 5′‐CTGGGCTCGAGGGGGGGCCCTGGAGAATCAAACAGACAG‐3′ for the left arm and 5′‐TGGGAAGCTTGTCGACTTAAGTAAGATCTTGGGGGCCCAG‐3′ and 5′‐CACTAGTAGGCGCGCCTTAACTTAAATTCCAAATGGCTGG‐3′ for the right arm. The PCR‐amplified left and right arms were inserted in marker‐gene plasmids (above described DT‐ApA/NEOR‐based plasmids) digested with ApaI and AflII using the GeneArt Seamless Cloning & Gibson Assembly system (Thermo Fisher Scientific, Pittsburgh, PA) to KO construct. The resultant KO plasmids express diphtheria toxin from outside of the homologous arms to suppress random integration events. The CRISPR expression vector for the CRISPR‐Cas9 system was designed to recognize 5′‐GAAGTACGTGCAAGGGGTGTATGG‐3′ (Figure S1). The loss of the PARP1 expression was confirmed by western blot using antibodies, anti‐PARP antibody (Santa Cruz Biotechnology, sc‐8007), and anti‐histone H3 antibody (Abcam, ab1791) for the loading control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!