The genomic region spanning wild-type R132 of IDH1 was analyzed by pyrophosphate sequencing using the following primers: (forward) 5'-GCTTGTGAGTGGATGGGTAAAAC-3' and (reverse) 5'-biotin-TTGCCAACATGACTTACTTGATC-3'. Polymerase chain reaction (PCR) was performed using the ABI PCR System 9700 (Applied Biosystems). Polymerase chain reaction amplification was performed in a 40 μl reaction volume containing 1 μl each of forward and reverse primer (10 μM), 4 μl 10× buffer, 3.2 μl dNTPs (2.5 μM), 2.5 U hotstart Taq (Takara), and 2 μl DNA (10 μM). The PCR conditions were as follows: 95° for 3 min; 50 cycles of 95°C for 15 s, 56°C for 20 s, and 72°C for 30 s; and 72°C for 5 min. After extraction from the amplified product, single-stranded DNA was subjected to bisulfate modification using the EpiTect Bisulfite Kit (Qiagen) and pyrosequencing using the PyroMark Q96 ID System (Qiagen) with the primer 5'- TGGATGGGTAAAACCT-3'.
Abi 9700 pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Switzerland
The ABI 9700 PCR system is a thermal cycler used for polymerase chain reaction (PCR) amplification of DNA samples. It is capable of performing standard PCR protocols and can accommodate a variety of sample volumes and tube formats.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (7 mentions)
Pyromark q96 id system, by Qiagen (2 mentions)
Pyromark assay design 2, by Qiagen (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Pyromark q96 id, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Primerscript rt reagent kit, by Takara Bio (2 mentions)
Lightcycler 480 sybr green 1 master, by Roche (2 mentions)
Abi 3730xl sequencer, by Thermo Fisher Scientific (2 mentions)
Hotstart taq, by Takara Bio (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Hotstar taq, by Takara Bio (1 mentions)
Genomic dna purification kit, by Thermo Fisher Scientific (1 mentions)
Pyromark assay design v2, by Qiagen (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Pyromark q96 48 id, by Qiagen (1 mentions)
Pyro q cpg software, by Biotage (1 mentions)
Rt pcr kit, by Takara Bio (1 mentions)
Totallab v2.01 image analysis software, by GE Healthcare (1 mentions)
Quantifast sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
16 protocols using abi 9700 pcr system
1
Pyrophosphate Sequencing of IDH1 R132
2
Bisulfite Conversion and Pyrosequencing for DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite modification was performed with an EpiTect bisulfite kit (QIAGEN, cat. no. 59104) completed as per the manufacturer’s instructions. Briefly, DNA was dissolved in 3.6 mol/l sulfite solution, to which 800 μl of RNase-free water was added and mixed thoroughly, added into a 200 μl PCR tube, mixed at room temperature, and set aside. A Stratagene Mx3005P Real-Time PCR Detector (Agilent Technologies, Santa Clara, CA, USA) was used for DNA sulfite transformation, in a reaction totaling 5 h. The reactions were then incubated overnight at 20°C within the thermocycler.
The pyrosequencing: primers were designed using PyroMark Assay Design 2.0 (Qiagen, Germany). These primers were: CNRIP1 F1: 5′-GGTTATTTTTTTTAAGTTTTGGAAAGATT-3′; CNRIP1 R1: 5′-ATTTACCCACCACAATCCCCTTCA-3′; CNRIP1 S1: 5′-GGATTAGAGAGTAGTAGTGTTTA-3′ (5′-end modified by Biotin). Primers were synthesized by the Shenzhen BGI Company. The PCR was undertaken using an ABI PCR System 9700 (Applied Biosystems). The pyrosequencing reaction was undertaken using a PyroMark Q96 ID Pyrosequencing detector (QIAGEN). The methylation status of each locus was analyzed automatically by the Pyro Q-CpG software.
The pyrosequencing: primers were designed using PyroMark Assay Design 2.0 (Qiagen, Germany). These primers were: CNRIP1 F1: 5′-GGTTATTTTTTTTAAGTTTTGGAAAGATT-3′; CNRIP1 R1: 5′-ATTTACCCACCACAATCCCCTTCA-3′; CNRIP1 S1: 5′-GGATTAGAGAGTAGTAGTGTTTA-3′ (5′-end modified by Biotin). Primers were synthesized by the Shenzhen BGI Company. The PCR was undertaken using an ABI PCR System 9700 (Applied Biosystems). The pyrosequencing reaction was undertaken using a PyroMark Q96 ID Pyrosequencing detector (QIAGEN). The methylation status of each locus was analyzed automatically by the Pyro Q-CpG software.
3
Detecting IDH1 Mutations and MGMT Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IDH1 mutations were identified using DNA pyrosequencing [36 (link)]. In brief, a QIAamp DNA Mini Kit (Qiagen) was used to isolate genomic DNA from frozen tumor tissue samples. The genomic region spanning the wild-type R132 of IDH1 was analyzed by amplifying a 75-base pair (bp) fragment with the following primers: 5′-GCTTGTGAGTGGATGGGTAAAAC-3′ and 5′-biotin-TTGCCAACATGACTTACTTGATC-3′. Duplicate PCR analyses were performed in 40 μL reaction tubes containing 1 μL each of 10 μM forward and reverse primers, 4 μL of 10 × buffer, 3.2 μL of 2.5 mM dNTPs, 2.5 U HotStar Taq (Takara), and 2 μL of 10 μM DNA. The PCR conditions were as follows: 95°C for 3 minutes, 50 cycles at 95°C for 15 seconds, 56°C for 20 seconds, 72°C for 30 seconds, and then 72°C for 5 minutes (ABI PCR System 9700; Applied Biosystems). Single-stranded DNA was purified from the PCR products and pyrosequenced with a PyroMark Q96 ID System (Qiagen) using a 5′-TGGATGGGTAAAACCT-3′ primer and an EpiTect Bisulfite Kit (Qiagen).
The methylation status of the MGMT promoter was also detected using DNA pyro-sequencing as previously reported [15 (link), 39 (link)].
The methylation status of the MGMT promoter was also detected using DNA pyro-sequencing as previously reported [15 (link), 39 (link)].
4
Silk Worm Tissue Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the ASG, AMSG, MMSG, PMSG and PSG, according to the same protocol as the sample preparation. Then, PrimeScript RT reagent kits (RR037A, Takara) were used to reverse transcribe the total RNA. All the primers were designed using Primer v5.0 software, and synthesized by the BGI company (Shenzhen, PR China) (S1 Table ). Ribosomal protein L3 (RPL3, BGIBMGA013567), a silkworm housekeeping gene, was selected as a control.
The RT-PCR mixture was performed in 10-μl volume containing 1 μl of 10 × PCR buffer, 0.8 μl of dNTPs, 0.1 μl of rTaq, 1 μl of primerF, 1 μl of primerR, 2 μl of template and 4.1 μl of ddH2O. The PCR reaction was performed in an ABI PCR System 9700 (Applied Biosystems) as follows: 94°C for 4 min, 25 cycles of 94°C for 10 s, 60°C for 15s, and 72°C for 30 s, and then 72°C for 7 min; and stored at 12°C or used immediately for detection.
The RT-PCR mixture was performed in 10-μl volume containing 1 μl of 10 × PCR buffer, 0.8 μl of dNTPs, 0.1 μl of rTaq, 1 μl of primerF, 1 μl of primerR, 2 μl of template and 4.1 μl of ddH2O. The PCR reaction was performed in an ABI PCR System 9700 (Applied Biosystems) as follows: 94°C for 4 min, 25 cycles of 94°C for 10 s, 60°C for 15s, and 72°C for 30 s, and then 72°C for 7 min; and stored at 12°C or used immediately for detection.
5
Genomic DNA Isolation and Bisulfite Conversion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was isolated from umbilical vessel tissues using Genomic DNA Purification Kit (Invitrogen, cat. K0512, USA). Bisulfite was converted using the EpiTect bisulfite kit (Qiagen, Valencia, CA) according to the manufacturer's instructions to deaminate cytosine to uracil; 5-methyl-cytosine was protected from deamination. PCRs were performed in an ABI 9700 PCR System (Applied Biosystems, USA) using an annealing temperature of 56°C.
6
DNA Methylation Analysis of Hippocampal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from hippocampal tissue samples using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and sodium bisulfite modification was performed using the Qiagen EpiTect Bisulfite Kit (Qiagen). Primers (forward: TTTTAATTAGGGATTTTTAAGAGGTTAGGT; reverse: CCACAAATACCAACCCTTAACACTTCTAAT) for amplifying the bisulfite-converted DNA sequences were designed using PyroMark Assay Design v2.0 software (Qiagen). PCR amplification was performed on an ABI 9700 PCR system (Applied Biosystems, Foster City, CA, United States). Pyrosequencing and analysis of DNA methylation status of all CpG sites were performed using PyroMark Q96 ID (Qiagen).
7
Quantifying DNA Methylation by Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sizeable, significant (P value <0.05 and |log2FC|>0.8, FC, fold change) DMRs were tested using pyrosequencing assay. Extracted DNA methylation was assessed using the Qiagen EpiTect Bisulfite kit (Qiagen, 59104). PCR amplification (ABI 9700 PCR System, Applied Biosystems) for 40 cycles was performed. Pyrosequencing was performed using PyroMark Q96/48 ID (Qiagen), and the final datasets were calculated using PyroQ CpG software (Biotage) according to the manufacturer's protocols [24 (link)].
8
Quantitative RT-PCR for VEGFR-2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
VEGFR-2 mRNA expression was determined by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). Total RNA was prepared from cultured cells using TRIzol reagent (Invitrogen, Grand Island, NY, USA). cDNA was generated using RT-PCR kit (TaKaRa, Otsu, Shiga, Japan). The following primers were used: VEGFR-2 forward 5ˊ-GGTCGCATGAACATGA AGAA-3ˊ and reverse 5ˊ-TTGGTAGGGTTTGTAAGGAC-3ˊ , and β-actin forward 5ˊ-CCTCTATG CCAACACAGTGC-3ˊ and reverse 5ˊ-GTACTCCTGCTTGCTGATCC-3ˊ . The reaction was performed using the ABI 9700 PCR system (Applied Biosystems, Foster City, CA) in 20 μl of reaction mixture. Cycling conditions included 30 cycles with denaturation at 94°C for 30 s, annealing at 55°C for 30 s and PCR product extension at 72°C for 1 min. PCR products were detected by 1.3% agarose gel electrophoresis and visualized using Ethidium Bromide staining. These experiments were independently performed three times. Statistical analysis of cell densitometry was performed using TotalLab v2.01 image analysis software (GE Healthcare, Waukesha, WI).
9
Validation of Candidate miRNAs by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The candidate miRNAs were further validated by qRT-PCR performed using the QuantiFast® SYBR® Green PCR Master Mix in an ABI 9700 PCR System (Applied Biosystems, Foster City, CA, USA). The relative expression values of the target miRNAs were normalized to that of RNU6B (U6), and the differences in gene expression were analyzed using the 2−∆∆Ct method. The primer sequence is shown in Table 1 .
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction and purification of total RNA were carried out as described above. RT-PCR analyses were performed with PrimerScript RT reagent Kit (Takara, China). Quantitative real-time PCR was performed using LightCycler 480 SYBR Green I Master (Roche, Switzerland) with the ABI 9700 PCR system (Applied Biosystems, USA). Reactions were run at 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Gene expression was measured by the standard curve method and normalized to the level of β-actin; the 2−ΔΔct method were used for calculations [19 (link)]. The PCR primer sequences are shown in Additional file 1 : Table S9.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!