Detection assays were performed with 45 nM purified Leptotrichia wadei Cas13a, 22.5 nM crRNA, 500 nM quenched fluorescent RNA reporter (RNAse Alert v2, Thermo Scientific), 2 μL murine RNase inhibitor (New England Biolabs) in nuclease assay buffer (40 mM Tris-HCl, 60 mM NaCl, pH 7.3) with 1 mM ATP, 1 mM GTP, 1 mM UTP, 1 mM CTP, and 0.6 μL T7 polymerase mix (New England Biolabs).
T7 polymerase mix
Manufactured by New England Biolabs
The T7 polymerase mix is a reagent used in molecular biology applications. It contains the T7 RNA polymerase enzyme, which is responsible for the transcription of DNA into RNA. The mix is designed to efficiently synthesize large quantities of RNA from a DNA template containing a T7 promoter sequence.
Automatically generated - may contain errors
6 protocols using t7 polymerase mix
1
Leptotrichia wadei Cas13a Assay
2
Leptotrichia wadei Cas13a-Mediated RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplified target was diluted 1:20 with 9 mM MgCl2, 45 nM purified Leptotrichia wadei Cas13a, 500 nM quenched fluorescent RNA reporter (RNAse Alert v2, Thermo Scientific), 2 μL murine RNase inhibitor (New England Biolabs) in nuclease assay buffer (40 mM Tris-HCl, 60 mM NaCl, pH 7.3) with 1 mM ATP, 1 mM GTP, 1 mM UTP, 1 mM CTP, and 0.6 μL T7 polymerase mix (New England Biolabs). This target mix was then loaded on to the chip by placing 10 µL of the mix on the sticky side of the PCR film (MicroAmp, Applied Biosystems) and pressing down the freeze-dried microarray chip on this mixture (Fig. 4B ; Figure S6A, Supplementary Material ) A weight was placed on the chip until the PCR film was stuck and the chip was incubated at 37°C for 3 hours.
After incubation, the reporter channel of the chip was imaged using a standard gel illuminator (E-gel Power Snap, Invitrogen) and a cellphone camera using the “macro” focus option (Figure S6B, Supplementary Material ). For cell phones without this option, a small lens band (Easy-Macro) was used to achieve focu of the microwells. The captured image was correlated with the pretest image and reporter signal for each crRNA-target pair was determined manually using ImageJ.
After incubation, the reporter channel of the chip was imaged using a standard gel illuminator (E-gel Power Snap, Invitrogen) and a cellphone camera using the “macro” focus option (
3
Generation of kif6dp20 Zebrafish Mutant
4
Integrated Nucleic Acid Detection Platform
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reactions of RPA‐HBV DNA amplification, T7 RNA polymerase‐in vitro transcription and Cas13a nuclease assay were integrated in one pellet. Briefly, a 25 µL of single‐pellet reaction solution consisted of 0.48 × 10−6m forward primer, 0.48 × 10−6m reverse primer, 1× RPA buffer, varying amounts of target DNA input, 1 U µL−1 murine RNase inhibitor, 2 × 10−6m each rNTP, 1 µL T7 polymerase mix (New England Biolabs), 45 × 10−9m LwCas13a protein, 22.5 × 10−9m crRNA, 250 × 10−9m quenched fluorescent RNA reporter, 5 × 10−3m MgCl2, and 14 × 10−3m MgAc. Reactions were proceeded for 2 h at 37 °C in a microplate reader for fluorescence kinetics measurement every 2 min.
5
Multiplex CRISPR Cas13a Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Droplets experiments were performed as previously described20 (link) using the DropArray platform. Briefly, detection sets were prepared at 2.2X final concentration of 45 nM purified Leptotrichia wadei Cas13a, 22.5 nM total crRNA concentration (1.25 nM of each of 18 crRNA for pooled detection; 22.5 nM of one crRNA for individual detection), 500 nM quenched fluorescent RNA reporter (RNAse Alert v2, Thermo Scientific), 2 μl murine RNase inhibitor (New England Biolabs) in nuclease assay buffer (40 mM Tris-HCl, 60 mM NaCl, pH 7.3) with 1 mM NTPs and 0.6 μl T7 polymerase mix (New England Biolabs). Amplified samples were diluted 1:10 into nuclease-free water supplemented with 13.2 mM MgCl2 prior to barcoding with fluorescent dyes. 20 µL of each sample and detection mix were then emulsified into droplets using a BioRad QX200 droplet generator using fluorous oil (3 M 7500, 70 µL) containing 2% 008-fluorosurfactant (RAN Biotechnologies.) Droplets were pooled and loaded into a DropArray chip, imaged for content identification by fluorescent barcode identification, droplet pairs merged and then incubated at 37 ˚C, and imaged for assay signal at 0, 1 h, and 3 h time points relative to the start of the incubation.
6
CRISPR-Cas9 Generation of kif6 dp20 Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The kif6 dp20 mutant zebrafish were developed using CRISPR-Cas9-mediated genome editing.
Using the CHOP-CHOP online tool (Labun et al., 2016) , we identified a suitable 20-nucleotide site (GGTCATCATGGAATTGCGGTAGG) targeting exon 8 of Danio kif6 (ENSDART00000103662.6) in order to generate non-synonymous p.P293T mutant allele. The gene specific and universal tracrRNA oligonucleotides (S1 Table ) were annealed, filled in with CloneAmp HiFi PCR premix, column purified, and directly used for in vitro transcription of single-guide RNAs (sgRNAs) with a T7 Polymerase mix (M0255A NEB). All sgRNA reactions were treated with RNAse free-DNAse. We utilized a ssDNA oligonucleotide (S1 Table ) to insert the desired base-pair changes, and a synonymous mutation which introduced an EcoRI site for genotyping (Supp. Fig. 2C). The kif6 p.P293T donor and locus specific kif6 sgRNA and purified Cas9 protein (Alt-R S.p. Cas9 Nuclease V3, IDT) were injected at the 1-cell stage. We confirmed segregation of the kif6 dp20 allele using several methods: allele-specific PCR, or EcoRI (NEB) digestion of the Kif6 exon14 amplicon, and Sanger sequencing of heterozygous carriers (Supp. Fig. 2C,D).
Using the CHOP-CHOP online tool (Labun et al., 2016) , we identified a suitable 20-nucleotide site (GGTCATCATGGAATTGCGGTAGG) targeting exon 8 of Danio kif6 (ENSDART00000103662.6) in order to generate non-synonymous p.P293T mutant allele. The gene specific and universal tracrRNA oligonucleotides (S1 Table ) were annealed, filled in with CloneAmp HiFi PCR premix, column purified, and directly used for in vitro transcription of single-guide RNAs (sgRNAs) with a T7 Polymerase mix (M0255A NEB). All sgRNA reactions were treated with RNAse free-DNAse. We utilized a ssDNA oligonucleotide (S1 Table ) to insert the desired base-pair changes, and a synonymous mutation which introduced an EcoRI site for genotyping (Supp. Fig. 2C). The kif6 p.P293T donor and locus specific kif6 sgRNA and purified Cas9 protein (Alt-R S.p. Cas9 Nuclease V3, IDT) were injected at the 1-cell stage. We confirmed segregation of the kif6 dp20 allele using several methods: allele-specific PCR, or EcoRI (NEB) digestion of the Kif6 exon14 amplicon, and Sanger sequencing of heterozygous carriers (Supp. Fig. 2C,D).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!