Appswe psen1de9 mice

Manufactured by Jackson ImmunoResearch

Sourced in Montenegro

APPswe/PSEN1dE9 mice are a genetically modified mouse model that expresses mutant forms of the human amyloid precursor protein (APP) and presenilin 1 (PSEN1) genes. This model is commonly used in research related to Alzheimer's disease.

Automatically generated - may contain errors

Lab products found in correlation

Anti aβ 4g8 antibody, by BioLegend (1 mentions) Alexa fluor 488, by Thermo Fisher Scientific (1 mentions) 85dbo j, by Jackson ImmunoResearch (1 mentions) B6c3 tg, by Jackson ImmunoResearch (1 mentions) C57bl 6, by Jackson ImmunoResearch (1 mentions)

Spelling variants of this product

APPSwe (17 citations) APPswe/PSEN1dE9 (11 citations) PSEN1dE9 (5 citations) APP/PS1 (APPswe + PSEN1dE9) transgenic mice (4 citations) APPswe/PSEN1dE9 (APP/PS1) mice (3 citations) APPswe/PSEN1dE9 double-transgenic AD mice (2 citations)

4 protocols using appswe psen1de9 mice

Detecting Amyloid-Beta Plaques in AD Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transgenic 12-month-old APPswe/PSEN1dE9 mice (The Jackson Laboratory) were anesthetized and perfused with 30 ml of ice-cold PBS and then with 4% paraformaldehyde in PBS. Brains were removed and postfixed at 4 °C overnight, followed by 20 and 30% sucrose in PBS at 4 °C overnight. Brains were cut into 30 μm coronal sections with a cryostat (Leitz 1900) at − 20 °C. Immunolabelling was performed using the anti-Aβ 4G8 antibody (1:100, Biolegend, CA). Anti-mouse-IgG conjugated with Alexa Fluor-488 (1:1000, Molecular Probes), were used as secondary antibodies. Finally, sections were washed four times for 10 min with PBS and then incubated with fNDs for 1 h at a concentration 0.1 nM. The sections were then washed four times for 10 min with PBS and mounted with mounting medium DAKO.

Morales-Zavala F., Casanova-Morales N., Gonzalez R.B., Chandía-Cristi A., Estrada L.D., Alvizú I., Waselowski V., Guzman F., Guerrero S., Oyarzún-Olave M., Rebolledo C., Rodriguez E., Armijo J., Bhuyan H., Favre M., Alvarez A.R., Kogan M.J, & Maze J.R. (2018). Functionalization of stable fluorescent nanodiamonds towards reliable detection of biomarkers for Alzheimer’s disease. Journal of Nanobiotechnology, 16, 60.

+ Open protocol

+ Expand

Alzheimer's Mouse Model Generation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

APPswe/PSEN1dE9 mice with a C57BL/6 background were obtained from The Jackson Laboratory (strain name, B6C3-Tg (APPswe, PSEN1dE9) 85Dbo/J; stock number 004462) (Jankowsky et al., 2004 (link)). Heterozygous males were bred with wild-type (WT) C57BL/6 females purchased from the Shanghai Research Center for Model Organisms (China). Offspring were genotyped using PCR with primers specific for the APP sequence (Forward: GAATTCCGACATGACTCAGG; Reverse: GTTCTGCTGCATCTTGGACA). Mice not expressing the transgene were adopted as the littermate WT controls. Seven-month-old males were used in all the studies. The animals were housed in groups with free access to water and chow in a temperature-controlled (20–22°C) vivarium and were maintained on a 12-h light/dark cycle. This study and all mouse care and experimental procedures were approved by the Medical Experimental Animal Administrative Committee of Fudan University.

Wang Z., Xiong L., Wan W., Duan L., Bai X, & Zu H. (2017). Intranasal BMP9 Ameliorates Alzheimer Disease-Like Pathology and Cognitive Deficits in APP/PS1 Transgenic Mice. Frontiers in Molecular Neuroscience, 10, 32.

+ Open protocol

+ Expand

Behavioral and Molecular Profiling of APP/PS1 Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

For behavioral testing and immunohistochemistry, we used 21 C57BL/6J wild type (WT) and 19 transgenic (TG) APPswe/PSEN1dE9 mice (Jankowsky et al., 2004 (link)) (Jackson Laboratories, Bar Harbor, ME) carrying human APP (K595N and M596L) and PSEN1dE9 mutations maintained in C57BL/6J background. These mice are referred to as APP/PS1 mice. Mice were randomized into vehicle or GW0742 treatment groups. Starting at the age of 12 months, the mice were administered with 30 mg/kg GW0742 in water suspension, or only water with the same volume, every 24 hr by oral gavage for 14 days. The mice were subjected to behavioral testing while under treatment and were killed for sample collection 12 hr after the final drug administration. For electrophysiology measurements, we used slices from 31 adult male WT mice. For cell culture assays, also WT mice with C57BL/6JRccHsd background were used.
All animals were group-housed in a controlled environment (temperature, 21 ± 1 °C; humidity, 50 ± 10%; light period, 7:00 a.m. to 7:00 p.m.) and had ad libitum access to food and water. Experiments were conducted according to the European Communities Directive (86/609/EEC) and approved by the Animal Experiment Board in Finland; or according to the Case Western Reserve University Institutional Animal Care and Use Committee guidelines.

Konttinen H., Gureviciene I., Oksanen M., Grubman A., Loppi S., Huuskonen M.T., Korhonen P., Lampinen R., Keuters M., Belaya I., Tanila H., Kanninen K.M., Goldsteins G., Landreth G., Koistinaho J, & Malm T. (2018). PPARβ/δ-agonist GW0742 ameliorates dysfunction in fatty acid oxidation in PSEN1ΔE9 astrocytes. Glia, 67(1), 146-159.

+ Open protocol

+ Expand

Panax notoginseng Saponins Mitigate Alzheimer's in APP/PS1 Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

APPswe/PSEN1dE9 mice with a C57BL/6 background were obtained from the Jackson Laboratory. APP/PS1 mice and wild-type littermate mice were genotyped by PCR analysis of genomic DNA from tail biopsies. Animals were maintained at 22±2 °C with a 12-h light:dark cycle (lights on at 8 AM, lights off at 8 PM) with free access to food and water. All mouse care and experimental procedures were conducted in accordance with the institutional guidelines of Peking University Shenzhen Graduate School.
XST is consisted of the total saponins from Panax notoginseng, and was provided by Guangxi Wuzhou Zhongheng Group Co., Ltd. Its major components are Notoginsenoside R1 (9.4%, PubChem CID: 441934), Ginsenoside Rg1 (38.0%, PubChem CID: 441923), Ginsenoside Re (4.8%, PubChem CID: 441921), Ginsenoside Rb1 (20.0%, PubChem CID: 9898279), and Ginsenoside Rd (1.1%, PubChem CID: 11679800). Freeze-dried powder of XST was dissolved in saline and administrated intraperitoneally (100 mg/kg), and saline injection was used as control. For experiments involving 30-day injection, XST were injected daily for 15 days in two sessions with a break of 2 days in-between; for 15-day injection, XST was injected for 15 days without any break; for measuring changes in the short-term (h) effect of XST, XST was injected only once.

Huang Y., Guo B., Shi B., Gao Q, & Zhou Q. (2018). Chinese Herbal Medicine Xueshuantong Enhances Cerebral Blood Flow and Improves Neural Functions in Alzheimer’s Disease Mice. Journal of Alzheimer's Disease, 63(3), 1089-1107.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!