Blue orange loading dye

Ogg1 activity was assayed using fly head homogenates as previously described [64] (link). Briefly, the heads from 15–18 anesthetized flies, aged 1 to 3 days, were collected on ice using a razor blade and homogenized in 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1 mM DTT, 0.5 mM spermine, 0.5 mM spermidine, protease inhibitor, and 50% glycerol. A 1∶10 volume of 2.5 M KCl was added to this homogenate and mixed at 4°C for 30 minutes. Samples were then centrifuged at 15,800× g for 30 minutes and the supernatant was collected and frozen at −80°C until use in the 8-oxo-dG repair assay. Ogg1 activity was measured at 37°C using 30 µg of protein extract and a ³²P-labeled synthetic probe containing 8-oxo-dG for the indicated times. The reaction was stopped by placing the solution on ice and adding 20 µl of loading buffer containing 90% formamide, 10 mM of NaOH, and Blue/Orange Loading Dye (Promega Corp., Madison, WI). The solution was then heated at 95°C for 3 min and placed on ice. The samples were loaded onto a polyacrylamide gel (20%) in 7 M urea and 1× TBE running buffer and run at 400 mV for 2 h. An FLA-3000 Series Fuji Film Fluorescent Image Analyzer was used to obtain images from the gel. All reagents used in this analysis were obtained from Sigma-Aldrich unless indicated otherwise (St. Louis, MO).

Bactotryptophan (code 91079-40-2); Bacto yeast (code 8013-01-2); Sodium Chloride (code 7647-14-5); Agar (code 9002-18-0); Calcium Chloride (code 10035-04-8); Isopropanol (code 67-63-0); Ethanol (code 64-17-5); SSC Buffer (code 6135-04-3); Hind III (code 81295-22-9); BGL II (code 81295-12-7); Ammonium Citrate Tribasic (code 3458-72-8); Citric Acid (code 77-92-9); Lysine (code 56-87-1); Ferrous Sulphate (code 7720-78-7) were all from Sigma Aldrich. Glycerol (code 56-81-5); Midiprep Kit, (code K0841); Agarose Gel (code 9012-36-6); Propidium Iodide (code 25535-16-4); DNA Digestion Kit (code AM1907); Ligation Buffer (code IVGN2104) were from Thermo Fischer Scientific. Ampicillin (code 69-52-3) and Tris Acetate Buffer (code 135852-26-5) were from Fischer Scientific; Blue-Orange Loading Dye was from Promega; Miniprep Kit was from Euro genomics and Ferric Chloride (code 7705-08-0) was from Merck Millipore.

The PCR reactions for the 11,009 bp fragment were performed under the following conditions: an initial heat denaturation step for 6 min at 94 °C, followed by 35 cycles of 94 °C for 15 s, 8.5 min at 68 °C with additional 10 s after each cycle and 80 °C for 10 s. At the end of each run melting curve analysis was performed with measurements at 1 °C intervals between 60 °C and 95 °C. To detect the amplification in real time, 1 μL 5× SYBR^® Green I in DMSO (Rockland Immunochemicals, Philadelphia, PA, USA) was added to each reaction. Instead of using 1 μL (60 ng) template DNA, samples were standardised to 1 × 10⁶ copies/μL, after having assessed the relative copy-number in each sample via the amplification of the 83 bp fragment. 1× ROX Reference dye was added to each sample. Primer Sequences were OLA: 5′-GGG AGA AGC CCC GGC AGG TTT GAA GC-3′ and D1B: 5′-ATG ATG TCT GTG TGG AAA GTG GCT GTG C-3′. Reactions were performed on a StepOnePlusTM Real Time PCR System (Applied Biosystems, Warrington, UK). The entire PCR product was run a 0.8% TBE agarose gel containing EtBr, using a 6× Blue/Orange Loading Dye (Promega Corporation, Madison, WI, USA). Samples were analysed under a Bio-Rad Gel Doc 2000 (Bio-Rad Laboratories, Watford, Hertfordshire, UK). A Lambda DNA/HindIII (Promega Corporation, USA) DNA ladder was used to determine the size of the loaded PCR product.

All nucleic acids, including DNAs (Y_1, biotin-labeled Y₁, FAM-labeled Y₂, Y₃, Y_L), mismatched DNAs, and RNAs (EZH2, miRNA 21) were purchased from Integrated DNA Technologies (Coralville, IA, USA). Y_L modified with both dark quencher (Iowa black RQ) at the 5′ end and cyanine dyes (Cy5) at an intra-molecular location was purchased from Integrated DNA Technologies. Agar powder was purchased from Sigma-Aldrich (St. Louis, MO, USA). Chemicals used in this experiment, which included ethidium bromide, a 25 bp DNA stepladder, 50 bp DNA ladder, and 6× blue/orange loading dye, were purchased from Promega (Fitchburg, WI, USA). TAE buffer (50×) and TBE buffer (10×) were purchased from Noble Biosciences (Suwon, Gyeonggi-do, Korea). SYBR gold nucleic acid gel stain (10,000×) and ultrapure Dnase/Rnase-free water were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Streptavidin-coated polystyrene beads (110 nm-sized) were purchased from Bangs Laboratories (Fishers, IN, USA).

Genomic DNA was isolated from 1.5 × 10⁹L. major promastigotes using Purelink Genomic DNA kit (K1820-01, Life Technologies, Germany) and was quantified by using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Germany). PHMB/gDNA polyplex formulations were prepared by adding and mixing 4.5 μg of gDNA with PHMB (0–54 μg) in a final volume of 30 μl water. Similarly, PHMB/CPG ODN or PHMB/CpG-R polyplexes were prepared by mixing 30 μg CpG ODN 1668 (M_w = 6058 g/mol, sequence TCCATGACGTTCCTGATGCT, Eurofins MWG Operon, Germany) or 15 μg of CpG-R with PHMB (0–54 μg) in a final volume of 30 μl water, respectively. After thorough mixing by pipette, the polyplexes were left at room temperature for 2 h prior to analysis. The samples were then combined with 6× Blue/Orange loading dye (Promega, Germany) and loaded onto a 1% agarose gel containing SYBR gold nucleic acid gel stain (S11494, Life Technologies, Germany) for electrophoresis.

Chromosomal DNA from overnight cultures of E. coli K-12 was isolated using GenElute™ bacterial chromosomal DNA isolation Kit (Sigma-Aldrich, UK) according to the manufacturer’s instructions. Mixtures of isolated chromosomal DNA and PHMB were prepared by titrating 0.5 μg of chromosomal DNA with PHMB (0–0.75 μg) in a final volume of 50 μl 1× PBS followed by incubation at 37 °C for 30 minutes. The resulting samples were combined with 6× Blue/Orange loading dye (Promega, UK) and analyzed by electrophoresis using 0.8% agarose gels containing ethidium bromide.