Chromatin immunoprecipitation (ChIP) experiments were performed with three biological replicates following the procedure as described previously (Mishra et al., 2007 (link), 2011 (link)). Antibodies used to capture protein–DNA complexes were α-GFP sepharose (ab69314; AbCam), α-Mif2 (a gift from Pam Meluh, Johns Hopkins University), α-Cdc5 (custom made by the D’Amours laboratory; Ratsima et al., 2011 (link); Robellet et al., 2015 (link)), and α-HA agarose (A2095; Sigma Aldrich). ChIP-qPCR was performed in a 7500 Fast Real-Time PCR System using Fast SYBR-Green Master Mix (Applied Biosystems, Foster City, CA) with the following conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. The enrichment was determined as percent input using the ΔΔCT method (Livak and Schmittgen, 2001 (link)). Primer sequences are listed in Table 2 .
α gfp sepharose
Manufactured by Abcam
Sourced in United Kingdom
α-GFP sepharose is a chromatography resin composed of agarose beads conjugated with an anti-GFP antibody. It is used for the purification and enrichment of GFP-tagged proteins from cell lysates or other biological samples.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
α ha agarose, by Merck Group (1 mentions)
Quickchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Cycloheximide (chx), by Merck Group (1 mentions)
α actin, by Merck Group (1 mentions)
α flag, by Merck Group (1 mentions)
α gfp, by Abcam (1 mentions)
Oligomycin a, by Cayman Chemical (1 mentions)
α gapdh, by GeneTex (1 mentions)
2 protocols using α gfp sepharose
1
Chromatin Immunoprecipitation (ChIP) Assay
2
Quantitative Analysis of PRMT3 and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies used were as follows: α-GFP (Abcam #ab290, Cambridge, UK), α-GFP Sepharose (Abcam #ab69314), α-PRMT3 (GeneTex #GTX23765, Irvine, CA, USA), α-asymmetrical dimethyl arginine (α-ADMA) (Cell Signaling Technology #13522, Denvor, MA, USA), α-GAPDH (GeneTex #GTX100118), α-Flag (Sigma, #F1804, St Louis, MO, USA), and α-Actin (Millipore #MAB1501, Birlington, MA, USA). Chemicals were as follows: SGC707 (Cayman #17017, Ann Arbor, MI, USA), cycloheximide (Sigma #C7698), heptelidic acid (BioVision #2215-250, Milpitas, CA, USA), and oligomycin A (Cayman #11342). Plasmids were as follows: The pEGFP-PRMT3 expression vector was kindly provided by Dr. Mien-Chie Hung [20 (link)]. pcDNA3-PRMT3 expression vector was a gift from Dr. Jian Jin. Human GAPDH cDNA ORF Clone was purchased from Sino Biological (#HG10094-NF, Beijing, China). R248K-GAPDH mutant was generated using a QuickChange site-directed mutagenesis kit according to the manufacturer’s protocol (Agilent Technologies #200519, Santa Clara, CA, USA). The primers used for mutagenesis are shown as follows (5´–3´):
F: GTGGTGGACCTGACCTGCAAGCTAGAAAAACCTGCC
R: GGCAGGTTTTTCTAGCTTGCAGGTCAGGTCCACCAC
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!