Platinum quantitative pcr supermix udg w rox

Manufactured by Thermo Fisher Scientific

Sourced in Germany

Platinum Quantitative PCR SuperMix-UDG w/ROX is a ready-to-use master mix designed for quantitative real-time PCR. It contains all the necessary components for PCR amplification, including DNA polymerase, dNTPs, and a proprietary buffer system.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using platinum quantitative pcr supermix udg w rox

Quantitative 16S rRNA Gene Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used a broad-coverage 16S qPCR assay developed by Liu and coworkers (Liu et al., 2012 (link)) to quantify the bacteria in samples. DNA yields from samples were quantified fluorometrically and 0.2 ng of template DNA was added to each 10 μl reaction containing 1.8 μM forward and reverse primer, 225 nM TaqMan^® probe, 1× Platinum Quantitative PCR SuperMix-UDG w/ROX (Invitrogen^TM) and molecular grade water. Each assay included a series of standards and a negative control (no DNA template). All assays were done in triplicate. Cycling parameters were: 3 min at 50°C for treatment with uracil-N glycosylase (UNG), 10 min at 95°C for Taq activation, 15 s at 95°C (denaturation), 1 min 60°C (annealing) and extension for 40 cycles. PCR amplification and real-time detection of fluorescence were performed using ABI 7900HT Real Time PCR system with StepOne Plus software (Applied Biosystems^TM).

Gliniewicz K., Schneider G.M., Ridenhour B.J., Williams C.J., Song Y., Farage M.A., Miller K, & Forney L.J. (2019). Comparison of the Vaginal Microbiomes of Premenopausal and Postmenopausal Women. Frontiers in Microbiology, 10, 193.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis of Mouse Brains

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice brains were dissected and immediately frozen in liquid nitrogen. Total RNA was extracted using Trizol reagent. RNA pellets were resuspended in diethylpyrocarbonate-treated water and RNA concentration was measured using a Nanodrop2000c spectrometer (Thermo Scientific). RNA was DNase treated (DNase I, amplification grade, Invitrogen) and then reverse-transcribed using the Superscript III First-Strand Synthesis System (Invitrogen). Relative quantification of gene expression was performed using Taq Manprobes and an ABI Prism 7000 Sequence Detection System. Platinum Quantitative PCR Super Mix-UDG w/ROX (Invitrogen) was used with the following primers and probes: App F-primer, (5’–3’) CCAAGAGGTCTACCCTGAACTGC; App R-primer, (5’–3’) AGGCAACGGTAAGGAATCACG; Actβ F-primer (5’–3’) GTGACGTTGACATCCGTAAAGA; Actβ R-primer (5’–3’) GTAACAGTCCGCCTAGAAGCAC; Slc12a5 F-primer (5’–3’) GGGCAGAGAGTACGATGGC; Slc12a5 R-primer (5’–3’) TGGGGTAGGTTGGTGTAGTTG. Assay efficiencies were experimentally determined using a five-point dilution series of cDNA spanning a 100-fold range in concentration. 0.025 µg cDNA template was used per reaction. Statistical analysis was performed on 2^-∆∆Ct values.

Chen M., Wang J., Jiang J., Zheng X., Justice N.J., Wang K., Ran X., Li Y., Huo Q., Zhang J., Li H., Lu N., Wang Y., Zheng H., Long C, & Yang L. (2017). APP modulates KCC2 expression and function in hippocampal GABAergic inhibition. eLife, 6, e20142.

+ Open protocol

+ Expand

Quantifying Gene Expression by qRT-PCR in CRC Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR analysis [28 (link)], total RNA was isolated from CRC cells using TRIZOL reagent (Sigma-Aldrich) and purified using the RNeasy mini kit including DNase (QIAGEN) according to the manufacturer's instructions (Figure S1). cDNA synthesis was performed using Superscript reagents (Invitrogen) according to the manufacturer's instructions. Quantitative real-time PCR was accomplished with SYBR green incorporation (Platinum Quantitative PCR SuperMix-UDG w/ROX; Invitrogen) using an ABI7900HT (Applied Biosystems), and the data were analyzed using SDS 2.3 software (Applied Biosystems). Results were normalized to those obtained with GAPDH, and data are presented as fold induction/repression over parental cells. Details of primers used are shown in Table S1. All assays were performed in triplicate at least three times.

Li N., Lorenzi F., Kalakouti E., Normatova M., Babaei-Jadidi R., Tomlinson I, & Nateri A.S. (2015). FBXW7-mutated colorectal cancer cells exhibit aberrant expression of phosphorylated-p53 at Serine-15. Oncotarget, 6(11), 9240-9256.

+ Open protocol

+ Expand

Quantification of Gene Expression in Pupal Heads

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pupal heads (84 h APF) were dissected in Jan’s saline (1.8mM Ca²⁺) and immediately frozen on dry ice. Total RNA was extracted using Trizol reagent. RNA pellets were resuspended in diethylpyrocarbonate (DEPC) treated water and RNA concentration was measured using a Nanodrop 2000c spectrometer (Thermo Scientific). RNA was DNase treated (DNase I, Amplification Grade, Invitrogen) and then reverse-transcribed using Superscript III First-Strand Synthesis System (Invitrogen).
Relative quantification of gene expression was performed using TaqMan probes and an ABI Prism 7000 Sequence Detection System. Platinum Quantitative PCR SuperMix-UDG w/ROX (Invitrogen) was used with the following primers and probes: gat F-primer, GGTTTGCTCCGTATCTGCTCTT; gat R-primer, GAGATTGGAAATATTCGCTGGG; gat-probe, 6FAM-TTTGGGAGCGGCGAGCTCTTCA-BHQ1; Rpl32 F-primer, GGCCCAAGATCGTGAAGAAG; Rpl32 R-primer, TAAGCTGTCGCACAAATGGC; Rpl32 probe, 6FAM-AGCACTTCATCCGCCACCAGTCG-BHQ1. Assay efficiencies were experimentally determined using a 5-point dilution series of cDNA spanning a 100-fold range in concentration (gat, 101%; Rpl32, 95%). 0.025 µg cDNA template was used per reaction. Statistical analysis was performed on 2^−ΔCt values.

Muthukumar A.K., Stork T, & Freeman M.R. (2014). Activity-dependent regulation of astrocyte GAT levels during synaptogenesis. Nature neuroscience, 17(10), 1340-1350.

+ Open protocol

+ Expand

Quantifying Bacterial Abundance and Composition

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total bacterial abundance (16S rRNA copies/µL) and the inferred concentrations of specific bacterial taxa (16S rRNA copies/µL) were performed as previously described^{76 (link)}. Standards from 1e7 to 10 copies and a no-template control were run in triplicate across all plates. Samples, primers, and probes were used with SsoAdvanced Universal Probes Supermix (Bio-Rad) or Platinum Quantitative PCR SuperMix-UDG w/ROX (Invitrogen) kits and run on a StepOnePlus Real-Time PCR System (Applied Biosystems). All samples were assayed in duplicate and were discarded if the Ct standard deviation was flagged as high or the Ct values were outside of the standard curve. Four samples had less than 100 total 16S rRNA copies and were not used in downstream analyses. Inferred concentrations of individual bacterial taxa were determined using Eq. 1:

{IC}_{x} = {RAb}_{x} \times {Ab}_{total}

Where IC_x is the inferred concentration of taxon x, RAb_x is the relative abundance of taxon x, and Ab_total is the total bacterial abundance.

Brown B.P., Feng C., Tanko R.F., Jaumdally S.Z., Bunjun R., Dabee S., Happel A.U., Gasper M., Nyangahu D.D., Onono M., Nair G., Palanee-Phillips T., Scoville C.W., Heller K., Baeten J.M., Bosinger S.E., Burgener A., Passmore J.A., Heffron R, & Jaspan H.B. (2023). Copper intrauterine device increases vaginal concentrations of inflammatory anaerobes and depletes lactobacilli compared to hormonal options in a randomized trial. Nature Communications, 14, 499.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared with the Trizol protocol (cat. 15596026; Invitrogen, Carlsbad, CA, USA), RNA was treated with DNase, and reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit, according to the manufacturer’s instruction (cat. 4368814; Applied Biosystems, Carlsbad, CA, USA). qRT-PCR reactions were performed, as previously described, using the Universal Probe Library system (Roche Diagnostics, Mannheim, Germany) and Platinum Quantitative PCR SuperMix-UDG w/ROX (cat. 11743500; Invitrogen, Carlsbad, CA, USA). Probes and oligonucleotide sequences used are reported in the Table S1. The 18S rRNA predeveloped TaqMan assay (cat. 4319413; Applied Biosystems, Carlsbad, CA, USA) was used as an internal control. PCR protocol is 50°C for a 2-min hold, 95°C for a 2-min hold, and 40 cycles of 95°C, 15 s; 60°C, 30 s.

Avalle L., Marino F., Camporeale A., Guglielmi C., Viavattene D., Bandini S., Conti L., Cimino J., Forni M., Zanini C., Ghigo A., Bogorad R.L., Cavallo F., Provero P., Koteliansky V, & Poli V. (2020). Liver-Specific siRNA-Mediated Stat3 or C3 Knockdown Improves the Outcome of Experimental Autoimmune Myocarditis. Molecular Therapy. Methods & Clinical Development, 18, 62-72.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!