The cloning of human TNKS1 constructs was conducted as previously described for CFP-ARC5 [43 (link)] or SAM-ART and ART domains [44 (link)]. Cloning of the YFP-REAGDGEE construct was conducted as previously described [43 (link)]. The E. coli codon-optimized constructs for A. queenslandica TNKS (AqTNKS: XP_019848937.1) were obtained as gBlock from IDT. The construct ARC5 (AqTNKS Glu658-Met811) was cloned into the pNIC-CFP expression vector (Addgene #173074). The AqTNKS constructs SAM-ART (Pro889-Thr1181) and ART (Thr968-Thr1181) were cloned into the pNIC-MBP vector, which was prepared as previously described [43 (link)]. Cloning was conducted using the SLIC method [45 (link)]. Briefly, the vectors were linearized and mixed with insert and T4 DNA polymerase. The reaction mixture was used to transform chemicompetent E. coli NEB 5α cells (New England BioLabs). Colonies were grown at 37 °C on LB agar plates containing 5% sucrose and 50 μg/mL kanamycin; genes in the vector encoding kanamycin-resistance and SacB enzyme [46 (link),47 (link)] served as selection markers for successful transformation and vector linearization, respectively. All constructs were verified by sequencing of the insert regions.
E coli neb5α cells
Manufactured by New England Biolabs
Sourced in United States
E. coli NEB5α cells are a high-efficiency chemically competent E. coli strain designed for routine DNA cloning and plasmid propagation. They provide reliable and consistent transformation efficiency.
Automatically generated - may contain errors
Lab products found in correlation
Bl21 de3, by New England Biolabs (2 mentions)
Abi 3130 sequencer, by Thermo Fisher Scientific (1 mentions)
Clonejet pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Impact kit, by New England Biolabs (1 mentions)
Ptxb1 vector, by New England Biolabs (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Merck Group (1 mentions)
8 protocols using e coli neb5α cells
1
Cloning of A. queenslandica TNKS constructs
2
CTV Genomic Variant Separation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to separate the different genomic variants presumably present in each CTV isolate, RT-PCR purified fragments were cloned with the CloneJET™PCR Cloning kit (Thermo Scientific Inc., Hanover, MD, USA), according to manufacturer’s instructions, followed by transformation of competent E. coli NEB5-α cells (New England BioLabs, Hertfordshire, UK). At least ten colonies for sample and gene, containing recombinant plasmids, were examined by PCR. The inserts of the recombinant clones were sequenced in both directions using the pJET1.2 universal primers in an ABI3130 sequencer (Applied Biosystems®, Foster City, CA, USA).
3
Protein Crystallographic Construct Design
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Protein Crystallographic Construct Design (ProteinCCD) metaserver was used to choose fragments from different domains of yeast and lancelet healing enzymes based on information acquired from various prediction servers for secondary structure, disorder, coiled coils, transmembrane segments, conserved domains, and domain linkers [34 (link)]. Multiple expression constructs encoding the PNK and CPDase domains of yeast tRNA ligase and full-length lancelet PNK/CPDase were assembled by sequence and ligation independent cloning (SLIC). The primers used are listed in (Additional file 1 ). Briefly, the DNA fragments of interest were amplified by polymerase chain reaction (PCR) from pET28a and pET20b plasmids harbouring ScTrl1 and BfPNK/CPDase, respectively [8 (link)]. The amplified products and linearized pET-his3C-LIC-amp vector (a kind gift from the Netherlands Cancer Institute) were separately treated with T4 DNA polymerase. The insert and vector were annealed, and the resulting plasmid was used to transform E. coli NEB5α cells (New England Biolabs, Germany). Transformed colonies were screened by colony PCR for recombinant plasmids that were purified, verified by sequencing, and used for protein expression.
4
Cloning Tau Fragments into pTXB1 Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). After cloning, the plasmid was amplified in E. coli NEB5α cells (New England Biolabs). Transformation of E. coli BL11 cells (New England Biolabs) was performed by mixing 25 μL cell suspension and 2 μL plasmid and incubating on ice for 30 mins. The mixture was heated to 42 °C for 30 s after which 475 μL LB medium was added followed by incubation at 37 °C for 1 h. 100 μL was spread on LB-Ampicilin+ agar plates and incubated overnight at 37 °C. 4 colonies were picked and transferred to 4 mL LB-Ampicilin+ and incubated for 8 h at 37 °C after which the mixture was diluted to 50 mL and further incubated overnight. 8 × 500 mL LB-Ampicilin+ was inoculated with sufficient overnight culture to reach an OD500 of 0.2 and incubated at 37 °C for approximately 2 h until the OD280 had reached 0.6. IPTG (Sigma) was added to a final concentration of 1 mM followed by further incubation for 3 h. Cells were harvested by centrifugation and stored at − 80 °C as 8 pellets until further use.
5
Cloning Protocol for E. coli NEB-5α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cloning purposes, chemically competent E. coli NEB-5α cells were purchased from New England Biolabs (NEB, Ipswich, MA, USA). Expression vectors were transformed into the E. coli strain BL21(DE3) (NEB). Cells were cultured and processed according to the manufacturer’s protocols. The primers were purchased from Sigma Aldrich (St. Louis, MO, USA) (Table S1, Supplementary Materials ).
6
Routine Bacterial Cloning and Biosynthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Routine cloning, plasmid propagation and phenylpropene biosynthesis were performed using E. coli NEB5α cells (New England Biolabs). Bacterial strains were grown in Lysogeny Broth (LB, Formedium) or on LB-agar (Formedium) supplemented with the appropriate antibiotics for plasmid selection unless stated otherwise. The standard antibiotic concentrations used were: 100 μg mL−1 carbenicillin, 50 μg mL−1 kanamycin, and 34 μg mL−1 chloramphenicol. All strains used and generated in this study are listed in Supplementary Table S1 .
7
Cloning and Genome Integration in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cloning purposes, chemically competent E. coli NEB-5α cells were purchased from New England Biolabs (NEB, Ipswitch, USA). For genome integration and I-SceI expression, E. coli BL21(DE3) (NEB) and HMS174(DE3) (Novagen, Madison, USA) were used. Cells were routinely cultured in Lysogeny Broth (LB) media, recovered in super optimal broth medium supplemented with 20 mM glucose (SOC media) and plated on LB agar. The following antibiotic concentrations were used: ampicillin (Amp) 100 µg/mL, chloramphenicol (Cm) 20 µg/mL. Shake flask cultivations were conducted in in semi synthetic medium with glycerol as sole carbon source at 37 °C. In the presence of the pAIO vector the temperature was set to 30 °C. Overnight cultures were grown in LB-medium supplied with chloramphenicol (20 µg/mL). In case of I-SceI induction, arabinose (0.4 M) was added to the culture.
8
Mutagenesis of E. coli EF-Tu Using Quikchange™
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pEECAHis30 (link), encoding for E. coli EF-Tu with a C-terminal hexahistidine tag, was used as the template for all mutagenesis reactions. The Quikchange™ method (Stratagene) employing two complementary primers was used in order to introduce the respective mutations. The primer sequences (only the coding stand primers are given) for construction of EF-TuH22G, EF-TuM112L, EF-TuM112A and EF-TuM112G variants were
(5′)GTACTATCGGCCACGTTGACGGT GGTAAAACAACGCTG(3′),
(5′)ACGGCCCGCTG CCGCAGACTCGAGAGCACAT(3′), (5′)TGACGGCCCGGCG CCGCAGACTCGAGAGCACATC(3′) and (5′)TGACGGCCCGGTG CCGCAGACTCGAGAGCACATC(3′), respectively. Template pDNA was degraded in a DpnI restriction digestion prior to transformation into competent E. coli NEB 5α cells (New England Biolabs) via heat shock. Single colonies were selected and isolated plasmid DNA was sequenced (MacroGen) to confirm the desired mutations.
(5′)GTACTATCGGCCACGTTGAC
(5′)ACGGCCCG
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!