Qubit fluorometric quantification method

DNA was extracted from all samples using the AllPrep PowerFecal DNA/RNA kit (Qiagen, Canada) following the manufacturer’s instructions. DNAs were quantified by the Qubit Fluorometric Quantification method (Invitrogen). The V4 region (based on Escherichia coli) of the 16S ribosomal RNA (rRNA) was targeted for amplification by PCR using the forward primer 515F GTGCCAGCMGCCGCGGTAA and the reverse primer 806R GGACTACHVGGGTWTCTAAT. The CS1 (ACACTGACGACATGGTTCTACA) and CS2 (TACGGTAGCAGAGACTTGGTCT) tags were used to add a barcode and Illumina adapters. Amplification was performed using Q5 High Fidelity DNA polymerase (New England BioLabs) with PCR cycles as follows: initial denaturation step of 98 °C for 30 s, before 23 cycles of 98 °C for 10 s, 58 °C for 15 s and 72 °C for 30 s, with a final extension at 72 °C for 2 min. The MiSeq platform was used for 2 × 250 bp paired-end sequencing of the resulting PCR products.

Total bacterial DNA from stools was extracted using the AllPrep PowerFecal DNA/RNA kit (Qiagen, Canada) following the manufacturer’s instructions. DNAs were quantified by the Qubit Fluorometric Quantification method (Invitrogen). DNA was sent to Génome Québec for Illumina HiSeq 4000 PE 100 bp sequencing for shotgun metagenomics.