Truncated rna ligase 2

Total RNA was isolated from embryonic testes using Ribozol. Thirty micrograms of total RNA was loaded on 12% urea-polyacrylamide (PAA) gel. The 19–30 nt fraction was excised and snap-frozen in liquid nitrogen in 400 μl 0.4 M NaCl. RNA was eluted from the gel overnight at 16 °C while shaking at 1,000 r.p.m. and then precipitated with 3 vol absolute ethanol. Pre-adenylated 3′-linker (/5′Phos/ TGGAATTCTCGGGTGCCAAGGAACTC /3′ddC/; 5′-DNA adenylation kit, NEB) was ligated to RNA overnight at 4 °C using Truncated RNA Ligase 2 (NEB). Ligation reactions were loaded onto 10% urea-PAGE, the 45–56 nt fraction was excised and nucleic acids extracted as above. 5′-Linker (5′- rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC -3′) was ligated to the samples using RNA Ligase 1 (NEB) overnight at 4 °C. Ligation reactions were loaded on 10% Urea-PAA gel, 72–83 nt fraction was excised and nucleic acids extracted as above. Extracted samples were reverse transcribed (primer sequence: 5′- GGAGTTCCTTGGCACCCGAGA -3′) and library amplified by PCR using standard Illumina primers. Final libraries were excised from the agarose gel and sequenced.