Chondroitin sulfate

Manufactured by Abcam

Sourced in United States

Chondroitin sulfate is a sulfated glycosaminoglycan composed of alternating residues of D-glucuronic acid and N-acetyl-D-galactosamine-4-sulfate. It is a structural component of cartilage and provides compressive strength, resilience, and lubrication to joints.

Automatically generated - may contain errors

Lab products found in correlation

Alexa fluor 568, by Abcam (2 mentions) Alexa fluor 488, by Abcam (2 mentions) Cytation 3 cell imaging multi mode reader, by Agilent Technologies (2 mentions) Collagen 1, by Abcam (2 mentions) Chst15, by Addgene (1 mentions) Mda mb 468, by American Type Culture Collection (1 mentions) Mda mb 231, by American Type Culture Collection (1 mentions) Osteocalcin, by Santa Cruz Biotechnology (1 mentions) Aggrecan, by Merck Group (1 mentions) Hyaluronan binding protein, by Merck Group (1 mentions) Collagen 2, by Santa Cruz Biotechnology (1 mentions) Goat anti mouse igg2b, by Thermo Fisher Scientific (1 mentions) Collagen 10, by Merck Group (1 mentions) Tgf β2, by Abcam (1 mentions) Runx2, by Abcam (1 mentions) Normal goat serum (ngs), by Thermo Fisher Scientific (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Vector Laboratories (1 mentions) Hyaluronic acid, by Abcam (1 mentions) Heparan sulfate, by Abcam (1 mentions) Igg isotype control, by Abcam (1 mentions)

5 protocols using chondroitin sulfate

Chondroitin Sulfate Regulation in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 and MDA-MB-468 human breast cancer cell lines were obtained from ATCC. The following antibodies were purchased: CHST15 (Novus Biologicals, Centennial, CO), actin (Santa Cruz Biotechnology, Santa Cruz, CA), chondroitin sulfate (Abcam, Cambridge, UK). The anti-CS-E antibody was developed as described by the Hsieh–Wilson laboratory.^{18 (link)} The plasmids pInducer-tet-shHOTAIR and pInducer-tet-shCtrl were constructed as described previously. LZRS-HOTAIR was a gift from Howard Chang (Addgene plasmid # 26110).
qRT-PCR primers of human genes: HOTAIR—forward, GGTAGAAAAAGCAACCACGAAGC; HOTAIR—reverse, ACATAAACCTCTGTCTGTGAGTGCC; CHST15—set #1 forward, AAGAGCTTCTGATCTCATCACCT; CHST15—set #1 reverse, CTTGGGTTTTCGCTGTCCATC; CHST15—set #2 forward, CAGCGAAAACCCAAGTGACAC; CHST15—set #2 reverse, CTCAATCCTAGTTGTGATGCTGT, 18S—forward, AGGATCCATTGGAGGGCAAGT; 18S—reverse, TCCAACTA CGAGCTTTTTAACTGCA; actin—forward, CTTCCCCTCCATC GTGGG; actin—reverse, GTGGTACGGCCAGAGGCG; GAPDH—forward, CGGAGTCAACGGATTTGGTCGTA; GAPDH—reverse, AGCCTTCTCCATGGTGGTGAAGAC.

Liu L.C., Wang Y.L., Lin P.L., Zhang X., Cheng W.C., Liu S.H., Chen C.J., Hung Y., Jan C.I., Chang L.C., Qi X., Hsieh-Wilson L.C, & Wang S.C. (2019). Long noncoding RNA HOTAIR promotes invasion of breast cancer cells through chondroitin sulfotransferase CHST15. International journal of cancer, 145(9), 2478-2487.

+ Open protocol

+ Expand

Cartilage Development and Aging in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6 female mice at 5 days (d), 10 weeks (w), and 24 w of age were obtained from Institute of Laboratory Animal Sciences (CAMS&PUMC, Beijing, China). All experimental protocols were approved by the Institute of Materia Medica Animal Authorities (No. 00003787, 27 May 2019).
Antibodies to the following antigens were used: aggrecan (Millipore, AB1031, Burlington, MA, USA), CD44 (BioLegend, 103028, San Diego, CA, USA), Chondroitin Sulfate (Abcam, ab11570, Cambridge, UK), collagen I (Abcam, ab34710, Cambridge, UK), collagen II (Santa Cruz, sc-52658, Dallas, TX, USA), collagen IX (Santa Cruz, sc-376969, Dallas, TX, USA), collagen XI (Lifespan, LS-C-352032, Seattle, WA, USA), hyaluronan binding protein (Millipore, 385911, Burlington, MA, USA), osteocalcin (Santa Cruz, sc-376835, Dallas, TX, USA), syndecan-1 (BioLegend, 142511, San Diego, CA, USA), and donkey anti-rabbit (Jackson, 34213ES60, West Grove, PA, USA) and goat anti-mouse IgG2b (Thermo, A-21144, Waltham, MA, USA).

Li M., Zhang L., Li J, & Zhu Q. (2022). Direct Reprogramming of Mouse Subchondral Bone Osteoblasts into Chondrocyte-like Cells. Biomedicines, 10(10), 2582.

+ Open protocol

+ Expand

Histological Analysis of Hydrogel Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

The hydrogels were fixed in 4% paraformaldehyde for 24 h, embedded in OCT compound, and processed using standard procedures. For the immunofluorescence microscopy, 20-µm-thick histological sections were used, which were fixed for 10 min with 4% paraformaldehyde in PBS at room temperature, washed three times with 1 × PBS, and permeabilized with 0.5% Triton-X for 10 min. Sections were washed with PBS and blocked for 45 min in blocking buffer (5% BSA and 0.5% Tween-20 in 1× PBS) containing 10% normal goat serum at room temperature. For immunostaining, sections were incubated overnight at 4 °C with collagen 10 (1:200, Sigma), RUNX2 (1:200, Abcam, Cambridge, UK), chondroitin sulfate (1:100, Abcam), TGF-β2 (1:200, Abcam), and DKK1 (1:200, Abcam). The secondary antibodies were goat anti-rabbit Alexa Fluor 568 and goat anti-mouse Alexa Fluor 488 (Abcam), which were incubated for 1 h at room temperature. Images were acquired using the Cytation 3 Cell Imaging Multi-Mode Reader (Biotek Instruments, Inc., Winooski, VT, USA). An automated detection of the fluorescent intensities was used to analyze the expression.

Muttigi M.S., Kim B.J., Choi B., Han I., Park H, & Lee S.H. (2020). Matrilin-3-Primed Adipose-Derived Mesenchymal Stromal Cell Spheroids Prevent Mesenchymal Stromal-Cell-Derived Chondrocyte Hypertrophy. International Journal of Molecular Sciences, 21(23), 8911.

+ Open protocol

+ Expand

Immunofluorescence Microscopy of dNP and Ad-MSC Co-culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunofluorescence microscopy, dNP cells co-cultured with primed and non-primed Ad-MSCs for 10 days were used. These cells were fixed for 10 min with 4% paraformaldehyde (PFA) in PBS at room temperature, washed three times with 1× PBS, and permeabilized with 0.5% Triton-X for 10 min. The cells were washed with PBS and blocked for 45 min in blocking buffer (5% BSA and 0.5% Tween-20 in 1× PBS) containing 10% normal goat serum (Gibco, New Zealand origin) at room temperature. For immunostaining, the cells were incubated overnight at 4 °C with cadherin-2 (1:200, Abcam), chondroitin sulfate (1:100, Abcam), and collagen 1 (1:200, Abcam). Then, they were incubated with the secondary antibodies goat anti-rabbit Alexa Fluor® 568 and goat anti-mouse Alexa Fluor® 488 (Abcam) for 1 h at room temperature. The cells were counterstained with DAPI (Vector Laboratories, Burlingame, CA, USA), and images were acquired using Cytation 3 Cell Imaging Multi-Mode Reader (Biotek Instruments, Inc., Winooski, VT, USA). The detected fluorescence intensities were used to analyze the expression.

Muttigi M.S., Kim B.J., Kumar H., Park S., Choi U.Y., Han I., Park H, & Lee S.H. (2020). Efficacy of matrilin-3-primed adipose-derived mesenchymal stem cell spheroids in a rabbit model of disc degeneration. Stem Cell Research & Therapy, 11, 363.

+ Open protocol

+ Expand

Immunofluorescent Analysis of Endothelial ECM

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specimens were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton-X; the specimens were then blocked in 0.1% bovine serum albumin. Antibodies against ZO-1 (1:150, Invitrogen, USA), heparan sulfate (1:150, Abcam, USA), hyaluronic acid (1:150, Abcam, USA), and chondroitin sulfate (1:150, Abcam, USA), or IgG isotype control (1:150, Abcam, USA, Supplementary Figure 1) were incubated with the specimens overnight at 4°C. The specimens were then washed with PBS and incubated with Alexa Fluor 488 IgG (Invitrogen, USA) at 37°C for 1 h. Nuclei were stained with DAPI (1:100, Sigma, USA) at 37°C for 20 min. Finally, all samples were imaged with a Leica SP5 confocal microscope (Leica microsystem, Germany). The mean optical density was measured to reflect the content of ZO-1, heparan sulfate, hyaluronic acid, and chondroitin sulfate in endothelial cells.

Zhao H., Zhu Y., Zhang J., Wu Y., Xiang X., Zhang Z., Li T, & Liu L. (2020). The Beneficial Effect of HES on Vascular Permeability and Its Relationship With Endothelial Glycocalyx and Intercellular Junction After Hemorrhagic Shock. Frontiers in Pharmacology, 11, 597.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!