CUT&RUN was performed on 0.35×106 TRM-like cells using the ChIC/CUT&RUN Kit (EpiCypher, 14-1048) with 1 μl anti-H3K4me3 (EpiCypher, 13-0041) or 1.5 μl anti-Tcf1 (C46C7, CST) antibodies, following the manufacturer’s protocol, except that 1× eBioscience Perm Buffer (Invitrogen, 00-8333) supplemented with Spermidine and cOmplete™EDTA-free Protease Inhibitor (Roche, 11836170001) was used during the incubation step with pAG-MNase and 0.5× eBioscience Perm Buffer during the wash steps. Libraries were prepared with the NEBNext Ultra II Library Prep Kit (New England Biolabs, E7645) and sequenced as PE150 on Illumina NovaSeq 6000. For data processing, see supplementary materials and methods .
Chic cut run kit
Manufactured by EpiCypher
The ChIC/CUT&RUN kit is a laboratory equipment product designed for chromatin immunoprecipitation (ChIP) and cleavage under targets and release using nuclease (CUT&RUN) assays. The kit provides the necessary reagents and protocols to perform these epigenetic profiling techniques.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using chic cut run kit
1
CUT&RUN Analysis of H3K4me3 and Tcf1 in TRM-like Cells
2
CTCF Binding Site Profiling by ChIC/CUT&RUN
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIC/CUT&RUN kit (EpiCypher Cat# 15–1016) was used to profile the CTCF binding sites, with 500,000 cells.19 (link) NEBNext® UltraTM II DNA Library Prep Kit for Illumina (Ilumina Cat# E7645S) was used to make the sequencing libraries. Sequencing was performed using Illumina NovaSeq platform for 150bp paired-end reads. Sequencing data was evaluated by FastQC and the adaptor sequence was trimmed using Trimmomatic (v0.39), followed by Bowtie2 alignment and removal of PCR duplicates by GATK (v4.2.3.0), MACS2 software was used for the narrow peak calling with the matched IgG control with the parameter ‘-p 0.05’.20 (link)
3
IRF1 Binding to CD74 Promoter Analyzed
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIC/CUT&RUN kit (EpiCypher Cat# 15–1016) and IRF1 Rabbit pAb (Abclonal Cat# A7692) were used to capture the IRF1 binding regions, followed by qPCR using primers targeting CD74 promoter region (FP: CTTAAAGTCGGTGCTGGAGAG, RP: CAAAAGGCAGCTTCACCAAAG). The experiment was done in duplicates to quantify the IRF1 binding signals at the CD74 promoter region. The amount of input DNA was normalized for the duplicate qPCR experiment.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!