Gateway bp clonase 2 enzyme mix

For C-terminal tagging MFSD1 was PCR amplified from cDNA prepared from dendritic cells (a gift from M. Sixt lab) (Fw primer:GATCTCGAGATGGAGGACGAGGATG; Rv primer: CGACCGGTAACTCTGGATGAGAGAGC) and digested with XhoI and AgeI (both New England Biolabs, Ipswich, Massasuchetts, USA). This MFSD1 fragment was cloned into XhoI/AgeI digested peGFP-N1 (Addgene, Cambridge, Massachusetts, USA). C-terminally eGFP tagged MFSD1 was further PCR amplified (Fw primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGAGGACGAGGAT; Rv primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATTACTTGTACAGCTC). This fragment was cloned using Gateway BP Clonase II Enzyme mix and Gateway LR Clonase II Enzyme Mix (ThermoFisher Scientific, Waltham, Massachusetts, USA) via donor vector pDonR211 into the final Doxycyclin inducible expression vector pInducer20 (Meerbrey et al., 2011 (link)) according to the manufacturer’s instructions. pInducer20-MFSD1-eGFP was amplified in stbl3 bacteria (ThermoFisher Scientific, Waltham, Massachusetts, USA).

Erysimum cheiranthoides RNA was extracted from 2-week-old seedlings and young leaves of 5-week-old plants using the SV Total RNA Isolation System (Promega Corporation, Madison, WI). cDNA was generated using SMARTScribe Reverse Transcriptase (Takara Bio USA, Ann Arbor, MI). Primers were ordered to include Gateway attB recombination sites (Supplemental Table S1), and the coding sequence was amplified from cDNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). The gel-purified amplicon was inserted into the pDONR207 vector using Gateway BP Clonase II enzyme mix and then into pEAQ-HT-DEST1 (Sainsbury et al., 2009 (link)) using Gateway LR Clonase II enzyme mix (ThermoFisher Scientific, Waltham, MA). The sequences of the inserted genes were verified with Sanger sequencing. All cloning was done using 10-beta Competent E. coli (NEB, Ipswich, MA), with transformations done using heat shock at 42 °C. Plasmids were purified using the Wizard Plus SV Minipreps DNA Purification System (Promega Corporation, Madison, WI) and transformed into Agrobacterium tumefaciens strain GV3101 using a freeze-thaw method (Weigel & Glazebrook, 2006 (link)).

All primers, plasmids and yeast strains used or generated in this study are listed in Supplementary Tables 1, 2 and 3, respectively.
The full-length GuCSyGT was amplified by polymerase chain reaction (PCR) using PrimeSTAR Max DNA Polymerase (TaKaRa Bio) with primers 1 and 2 (Supplementary Table 1) from the first-strand cDNA of G. uralensis. The initial denaturation step (98 °C for 1 min) was followed by 35 cycles of 98 °C for 10 s, 55 °C for 5 s and 72 °C for 10 s. The amplified cDNA was cloned into pENTR™/D-TOPO^® (Thermo Fisher Scientific) to produce an entry clone. Similarly, the GuUGT73F13 entry clone was obtained using primers 19 and 20. The LjCSyGT entry clone was produced from first-strand cDNA of L. japonicus using primers 3 and 4.
Full-length GmCSyGTs (GmCSyGT1, GmCSyGT2 and GmCSyGT3) and GmCslMs (GmCslM1 and GmCslM2) were amplified by PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa Bio) with primers 5 and 6, 7 and 8, 9 and 10, 11 and 12 and 13 and 14, respectively, from the first-strand cDNA. The amplified cDNAs were each cloned into pDONR™221 (Thermo Fisher Scientific) using Gateway™ BP Clonase™ II Enzyme Mix (Thermo Fisher Scientific) to produce the corresponding entry clones. The GuCSyGT and LjCSyGT cDNAs were also cloned into pDONR™221 using the primer pairs, 21 and 22, and 23 and 24, respectively, for transformation of L. japonicus hairy roots.

To produce each construct, the coding sequence of each gene was amplified from whole larva cDNA using the PrimeScript RT-PCR Kit (cat #RR014-A; Takara). The amplified sequence was then purified through gel extraction (cat #D2111-03; Magen HiPure Gel Pure DNA Mini kit). Flanking att sequences were added through another round of PCR (cat #R011; Takara) and purified. The resulting products were then recombined into pDONR221 (cat #12536017; Thermo Fisher Scientific) through a Gateway BP reaction with Gateway BP Clonase II Enzyme Mix (cat #11789020; Thermo Fisher Scientific) to produce pDONR221-p24 entry clones. From there, p24 sequences were transferred into modified Gateway destination vector pTSGW (UASt-Signal peptide of Tango1-GFP-Gateway cassette) (Yang et al., 2021 (link)) through Gateway LR recombination using LR Clonase II Plus enzyme (cat #12538120; Thermo Fisher Scientific) to obtain the desired plasmids.
Primers used were as follows: Eclair-F, Eclair-R, att-Eclair-F, and att-Eclair-R; CHOp24-F, CHOp24-R, att-CHOp24-F, and att-CHOp24-R; Logjam-F, Logjam-R, att-Logjam-F, and att-Logjam-R; and Baiser-F, Baiser-R, att-Baiser-F, and att-Baiser-R. Primer sequences are listed in Table S2.

Bacterial strains and plasmids are listed in Supp. Table 1. For mutant construction, homologous downstream and upstream arms of genes of interest were amplified using the primers listed in Supp. Table 7. The amplified fragments were cloned into pDONRPEX18Gm attP sites using the Gateway BP Clonase II Enzyme mix (ThermoFisher). Plasmids were transformed into E. coli S17-1 λ-pir and confirmed by sequencing prior to conjugation. Conjugants were streaked onto LB plates (without NaCl) + 10% sucrose, and then tested for gentamicin resistance. Gentamicin-sensitive strains were tested for the deletion by PCR and sequencing.

Erysimum cheiranthoides RNA was extracted from 2-week-old seedlings and young leaves of 5-week-old plants using the SV Total RNA Isolation System (Promega Corporation, Madison, WI). cDNA was generated using SMARTScribe Reverse Transcriptase (Takara Bio USA, Ann Arbor, MI). Primers were ordered to include Gateway attB recombination sites (Supplemental Table S1), and the coding sequence was amplified from cDNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). The gel-purified amplicon was inserted into the pDONR207 vector using Gateway BP Clonase II enzyme mix and then into pEAQ-HT-DEST1 (Sainsbury et al., 2009 (link)) using Gateway LR Clonase II enzyme mix (ThermoFisher Scientific, Waltham, MA). The sequences of the inserted genes were verified with Sanger sequencing. All cloning was done using 10-beta Competent E. coli (NEB, Ipswich, MA), with transformations done using heat shock at 42 °C. Plasmids were purified using the Wizard Plus SV Minipreps DNA Purification System (Promega Corporation, Madison, WI) and transformed into Agrobacterium tumefaciens strain GV3101 using a freeze-thaw method (Weigel & Glazebrook, 2006 (link)).