The largest database of trusted experimental protocols

11 protocols using ck 869

1

MDCK Cell Culture and Osmotic Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following reagents were used in this study: blebbistatin (Thermo Fisher Scientific) used at 25 μM, HGF (R&D Systems) used at 25 ng/ml, CK666 (Sigma) used at 200 μM, and CK869 (Sigma) used at 30 μM. Cells were treated with the indicated inhibitors for 1–2 h at 37°C. For hypo-osmotic media, regular media was diluted 1:5 with H2O, as previously reported (17 ). For hyperosmotic solutions, 300 mM sorbitol (MilliporeSigma) was applied.
MDCK I and II cells (23 (link),24 (link)) are maintained by the European Collection of Authenticated Cell Cultures (ECACC) and were purchased through MilliporeSigma. Human foreskin fibroblasts (HFFs) and parental MDCK (NBL-2) cells were purchased from the American Tissue Type Collection (ATCC). All cells were used at passages 8–25 and were maintained in phenol red-free DMEM (HyClone) containing 7.5% FBS (MilliporeSigma), 4.5 g/liter glucose, 100 U/ml penicillin, 100 mg/ml streptomycin (Invitrogen), and 2mM L-glutamine (Life Technologies) at 37°C and 10% CO2.
+ Open protocol
+ Expand
2

Efficient Inhibition and Knockdown Strategies

Check if the same lab product or an alternative is used in the 5 most similar protocols
The small-molecule inhibitors were SMIFH2 (Sigma s4826, 60 microM), CK-869 (Sigma C9124, 80 microM) LatrunculinA (Sigma L5163, 0.5 microM), G2 (Xcessbio M60269 for cell treatments, Valuetech custom synthesis for mouse injections). All plasmids were sequence-verified before use and transfected as endotoxin-free maxi preps. siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo). shRNAs were selected among pre-validated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector25 (link). Sequences of siRNAs are provided in Table 1.

siRNA and shRNA sequences.

Target genesiRNA or shRNA Sequence
hFSCN1 AUGGCAAGUUUGUGACCUCC
hFSCN1 BCAGCGUCACCCGUAAGCGC
hCAPZB AGAAGUACGCUGAACGAGAUck
hCAPZB BGGAGUGAUCCUCAUAAAGA
AllStars negative control (Qiagen)Not available—proprietary information
Scramble control shRNAUUCUCCGAACGUGUCACGU
mFSCN1 A

CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGC

TACTAGCGGATGCTTTTTG

mFSCN1 B

CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAG

GATAACAGGAGGTTTTTG

+ Open protocol
+ Expand
3

Actin Cytoskeleton Modulating Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
CytoD (25023; EMD Millipore), CK-869 (C9124; Sigma-Aldrich), and jasplakinolide (1689-05; BioVision) were dissolved as recommended by the manufacturers and used at the indicated concentrations. Controls for each drug treatment contained the relevant solvent only.
+ Open protocol
+ Expand
4

Larval Zebrafish Acoustic Startle Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
For all exposures, groups of 10–20 larvae (5 dpf) were incubated for specified periods of between 30 minutes and 16 hours within 35 mm Petri dishes in 2 mL of each drug solution. Drug solutions remained on larvae during startle testing for 30 minutes to 1-hour exposures. For 16-hour incubations larvae first received fresh E3 prior to testing. Following incubation, larvae were placed on the 6×6 acrylic testing grid and run through the acoustic startle assay. CK-869, CK-666, MK-801, N-phenylanthranilic acid (NPAA), meclofenamic acid (MA), phenoxybenzamine (POBA), etazolate (ETAZ), BMS 204352, muscimol, and baclofen were obtained from Sigma-Aldrich. SMIFH2, IPA-3, GSK429286 and NSC23766 were acquired from Tocris through Fisher Scientific.
+ Open protocol
+ Expand
5

Antibody Validation for Virus Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
α-sarcin was purchased from Santa Cruz. 35S methionine and 35S cysteine were purchased from Perkin Elmer. Alexa FluorA647 succinimidyl ester was purchased from ThermoFisher Scientific. Inhibitors were purchased from commercial vendors as follows: Aim-100 (Apexbio), Wiskostatin (Sigma), Dynasore (Sigma), Pitstop-2 (Sigma), CK-869 (Sigma), Pirl1 (Hit2leads). Anti-EMCV mouse polyclonal antibodies were provided by Michael Diamond. Anti-poliovirus antibodies were provided by Nihal Altan-Bonnet. Other antibodies were obtained from commercial vendors as follows: Anti-coxsackie virus B3 antibodies (ThermoFisher), Anti-adenovirus A5 antibodies (ThermoFisher), Anti-influenza A virus NP antibodies (Millipore), Anti-TNK2 (A11) (Santa Cruz), Anti-WASL (Abcam and Sigma), Anti-actin, clone C4 (Sigma), Anti-NCK1 (Millipore), enterovirus D68 Ab (GeneTex), Anti-HA (ThermoFisher), Anti-Flag (GenScript), Anti-c-Myc (Invitrogen), Anti-double stranded J2 antibodies (Scicons).
+ Open protocol
+ Expand
6

Lentiviral Transduction of JY Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
EBV-transformed B cells (JY line) were cultured in RPMI 1640 GlutaMax, supplemented with 10% Fetal Calf Serum, minimum essential amino acids, HEPES, sodium pyruvate and Streptomycin/penicillin solution (Invitrogen) Cells were routinely screened for mycoplasm contamination using the MycoAlert mycoplasma detection kit (Lonza). For the stable expression of GFP, LifeAct-GFP, LifeAct-RFP, 1 × 105 JY cells were transduced with a lentiviral vector encoding LifeAct-TagGFP2 or LifeAct-TagRFP (Ibidi) over 6 h in RPMI-1640 containing 5% FCS and polybrene (4 μg ml−1). Transfected cells were selected by culturing them in the presence of 2 μg ml−1 puromycin for 7 days, added 24 h after transfection. Bright GFP-positive cells were further selected by flow cytometry sorting. Where indicated, cells were treated with Y27632 (Abcam) at 10 μM, CK 869 (Sigma-Aldrich) at 50 μM or the equivalent concentration of DMSO (10−3). No treatment toxicity was detected in a window of 16 h. IbitreatTM (Ibidi) plastic plates were coated with 1,5 μg ml−1 collagen type IV from human placenta or 10 μg ml−1 fibronectin from human plasma (both from Sigma-Aldrich) diluted on PBS. Matrices were incubated ON at 4 °C and 1 h at 37 °C before washing with medium and cell seeding.
+ Open protocol
+ Expand
7

Activation of Immune Cells Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following chemicals were used at the indicated concentrations: ionomycin (Iono, 2 μM), phorbol 12-myristate 13-acetate (PMA, 162 nM), CK-869 (100 μM), KN-93 (0.25 μM), KN-62 (2.5 μM), STO-609 (5 μM), and aphidicolin (15 µM) were all obtained from Sigma-Aldrich, whereas cyclosporine A (1 µM) and 187-1 (NWASPi, 3 µM) were obtained from TOCRIS Bioscience. Of note, aphidicolin and NWASPi are very unstable and lose activity within 7 d and 2 d, respectively, post reconstitution and storage at –20°.
+ Open protocol
+ Expand
8

Inhibiting Cellular Cytoskeletal Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were treated with 50 µM blebbistatin (Sigma-Aldrich, St Louis, MO USA) to inhibit myosin II ATPase activity, 400 nM latrunculin A (Enzo Life Sciences) to sequester actin monomers, 1 µM thapsigargin to inhibit Ca2+ uptake into the ER, 1 µM cytochalasin D (Sigma) to depolymerize actin, 10–50 µM cyclosporin A (Sigma) to inhibit calcineurin, 1–10 µM KN93 or KN62 (Tocris) to inhibit Ca2+/calmodulin-dependent protein kinase II, 10–20 µM Y27632 (Sigma) to inhibit ROCK, 2.5 µg/µl C3 transferase (Cytoskeleton) to inhibit Rho1, 1 µM nocodazole (Sigma) to depolymerize microtubules, 10–20 µM SMIFH2 (Sigma) to inhibit formins and 50–100 µM CK666 or CK869 (Sigma) to inhibit the ARP2/3 complex.
+ Open protocol
+ Expand
9

Osmotic Stress and Actin Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following reagents were used in this study: blebbistatin (Thermo Fisher Scientific) used at 25 µM, HGF (R&D Systems) used at 25 ng/ml, CK666 (Sigma) used at 200 µM, and CK869 (Sigma) used at 30 µM. Cells were treated with the indicated inhibitors for 1-2 h at 37°C. For hypo-osmotic media, regular media was diluted 1:5 with H2O, as previously reported (17) . For hyperosmotic solutions, 300 mM sorbitol (MilliporeSigma) was applied. MDCK I and II cells (23, 24) are maintained by the European Collection of Authenticated Cell Cultures (ECACC) and were purchased through MilliporeSigma. Human foreskin fibroblasts (HFFs) and parental MDCK (NBL-2) cells were purchased from the American Tissue Type Collection (ATCC). All cells were used at passages 8-25 and were maintained in phenol red-free DMEM (HyClone) containing 7.5% FBS (MilliporeSigma), 4.5 g/liter glucose, 100 U/ml penicillin, 100 mg/ml streptomycin (Invitrogen), and 2mM L-glutamine (Life Technologies) at 37°C and 10% CO2.
+ Open protocol
+ Expand
10

Evaluation of Small-Molecule Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
The small-molecule inhibitors were SMIFH2 (Sigma s4826, 60 microM), CK-869 (Sigma c9124, 80 microM) LatrunculinA (Sigma L5163, 0.5 microM), G2 (Xcessbio M60269 for cell treatments, Valuetech custom synthesis for mouse injections). All plasmids were sequenceverified before use and transfected as endotoxin-free maxi preps. siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo). shRNAs were selected among prevalidated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector (24)
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!