Between 0.7 and 1 μg RNA, extracted as above, was reverse-transcribed using qScript™ cDNA SuperMix synthesis kit (Quanta BioSciences, Inc., Gaithersburg, MD). Quantitative Real Time PCR was carried out in triplicates using a CFX96 instrument (Bio-Rad Laboratories, Inc., Hercules, CA), the Maxima SYBR Green/Fluorescein Master Mix (Thermo Fisher Scientific, Waltham, MA), and the primers listed in Supplemental Table S1 . Relative mRNA expression values were normalized to those of either 18S RNA (ST2 cells) or Gapdh mRNA (NeMCO), which themselves varied minimally across samples.
Maxima sybr green fluorescein master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
Maxima SYBR Green/Fluorescein Master Mix is a ready-to-use PCR reaction mix that contains SYBR Green I dye and fluorescein for real-time quantitative PCR (qPCR) applications. The mix includes all necessary components for efficient amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Maxima sybr green fluorescein qpcr master mix, by Qiagen (2 mentions)
Rotor gene q, by Qiagen (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Qscript cdna supermix synthesis kit, by Quanta Biosciences (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
4 protocols using maxima sybr green fluorescein master mix
1
Quantitative Real-Time PCR Analysis
2
Quantifying Gene Expression Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the mRNA expression of the cells (HDFs, HaCaTs, and HAECs) treated with TGFβ1 (10 ng mL−1) or TGFβ1 (10 ng mL−1)/PTβR2I (10 µg mL−1) under high glucose conditions, RNA was extracted using Trizol (Invitrogen) and reverse transcribed using a cDNA synthesis kit (Applied Biosystems). Gene expression was performed by real-time RT-PCR, using Maxima SYBR Green/Fluorescein Master Mix (Thermofisher) and selected primer pairs (Supplementary Table 1 ). β-actin served as the housekeeping gene. The ΔΔCt method was used for data analysis73 (link),127 .
3
Rat Hepatic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy Mini kit (Qiagen, U.S.A.) was used to separate the RNA content of rat hepatic cells. Maxima® SYBR Green/Fluorescein Master Mix (Fermentas, U.S.A.) was used to evaluate the total RNA amount. One microgram of RNA was reverse transcribed into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen, U.S.A.). PGC-1, TFAM, mTOR, cyclin D1, Nrf2, HO-1, and PCNA mRNA levels in rat hepatic lysate were determined using Maxima® SYBR Green/Fluorescein qPCR Master Mix by Rotor-Gene Q (Qiagen, U.S.A.). Moreover, rat β-actin was used as a housekeeping gene and internal reference control. The work was done using Applied Biosystem StepOne Plus, Foster City, CA, U.S.A. The gene specific PCR primers used were summarized in Table 1 .
The primers set used for detection of gene expression in rats.
| Gene symbol | Primer sequence from 5′-3′ | Gene bank accession number |
|---|---|---|
| β-actin | F: TCCGTCGCCGGTCCACACCC | NM_031144.3 |
| PGC-1 | F: ACATCGCAATTCTCCCTT | XM_032916070.1 |
| TFAM | F: AATGTGGGGCGTGCTAAGAA | NM_031326.2 |
| mTOR | F: CTGCACTTGTTGTTGCCTCC | NM_019906.2 |
| Cyclin D1 | F: TCGACGGCCATTACCAATCG | X75207.1 |
| PCNA | F: AGTTTTCTGCGAGTGGGGAG | NM_022381.3 |
| Nrf2 | F: 5′-CTCTCTGGAGACGGCCATGACT-3′ | NM_031789 |
| HO-1 | F: 5′-CACCAGCCACACAGCACTAC-3′ | NM_012580 |
4
Quantitative Analysis of Nrf2 Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The procedure was conducted as described previously by our group [23] [24] [25] . Briefly, total RNA was extracted using an RNeasy Mini kit (Qiagen, USA), and the concentration was evaluated with a Maxima® SYBR Green/Fluorescein Master Mix (Fermentas, USA). Then, 1 µg RNA was reverse transcribed into cDNA by a QuantiTect® Reverse Transcription Kit (Qiagen, USA). The expression levels of Nrf2, HO-1, ERK5, PKCδ, ADAMTS-4, aggrecans, MMP3, and VEGF mRNA in rat hepatic lysates were measured with Maxima® SYBR Green/Fluorescein qPCR Master Mix and Rotor-Gene Q (Qiagen, USA). Finally, for housekeeping and internal referencing, rat glyceraldehyde 3-phosphate dehydrogenase Table 1. Primer Sequences for real-time PCR assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!