Total RNA was prepared from the various treated cells using RNAprep Pure Cell Kit (TIANGEN, DP430) according to the manufacturer’s instructions. Each RNA sample was then reverse transcribed into cDNAs using RevertAid™ First Strand cDNA Synthesis Kit (Thermo Scientific, K16225). cDNA and appropriate primers were plated in a 96-well plate and gene expression levels were measured using Universal SYBR Green Fast qPCR Mix (ABclonal, RK21203) with a Bio-Rad CXF96 PCR system (Hercules, CA, USA). Each sample was repeated three times. 2−ΔΔCt method was used to quantify the relative gene expression level, with β-actin as the reference gene. All qRT-PCR Primer sequences are showed in Additional file 1 : Table S1.
Cxf96 pcr system
Manufactured by Bio-Rad
Sourced in Germany, United States
The CXF96 PCR system is a real-time PCR instrument designed for rapid and precise nucleic acid amplification and detection. It features a 96-well format and utilizes advanced optical components to provide accurate and reliable results.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Quantinova sybr green pcr kit, by Qiagen (4 mentions)
Deoxyribonuclease 1, by Thermo Fisher Scientific (2 mentions)
Sybr green realmastermix, by Eppendorf (2 mentions)
Rnaprep pure cell kit, by Tiangen Biotech (1 mentions)
Universal sybr green fast qpcr mix, by ABclonal (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol, by Takara Bio (1 mentions)
Sybr premix ex taqtm, by Bio-Rad (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Promega (1 mentions)
8 protocols using cxf96 pcr system
1
Quantitative Gene Expression Analysis
2
Quantitative RT-PCR for mRNA and lncRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissue or cell lines was isolated using TRIzol reagent (Ambion, Life Technologies, USA). The RNA was then reverse transcribed to complementary DNAs (cDNA) by RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Lithuania, USA). RT-qPCR was performed using a QuantiNova™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany) with a Bio-Rad CXF96 PCR system (Hercules, CA, USA) according to the manufacturer's instructions. GAPDH was used as reference gene for mRNA and lncRNA detection. Relative mRNA and lncRNA expression was determined by the 2−ΔΔCt method. The qRT-PCR primers were purchased from Sangon Biotech (Shanghai, China). LINC01003: F-5′-TCTCTGCGTCGCTCCTTCTCGC-3′, R-5′-CCTTCCGCGCCAAGTAGTGC-3′; CAV1: F-5′-GACTCGGAGGGACATCT CTACACC-3, R-5′-GTCGTACACTTGCTTCTCGCTCAG-3′.
3
Comprehensive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the RT–PCR experiment, total RNA from the constructs was isolated with TRIzol (Takara, Tokyo, Japan) and converted into complementary DNA (cDNA) using the PrimeScript RT reagent kit (Takara, Tokyo, Japan). The cDNA was amplified by an RT–PCR system containing SYBR Premix Ex TaqTM and primers (for typical hypoxia, chondrogenic, osteogenic and vascular genes) using a Bio-Rad CXF96 PCR system (Bio-Rad Laboratories, USA). The hypoxia genes included HIF-1α and PHD2. The chondrogenic differentiation genes include Col II, Sox 9 and Acan. The osteogenic differentiation genes included TGF-β1, BMPR1A, BMPR1B, BMP2, RUNX2, OPN, OCN, and Col I. The vascular genes included VEGF, SCF, and PLGF. Primer sequences used in this study were listed in Table S2 .
4
Extracting and Quantifying RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from frozen brain tissues and cultured cells were extracted using Trizol reagent (Ambion, life technologies, Carlsbad, CA, USA) as previously described [19] . cDNA from total RNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Scienti c, Vilnius, Lithuania, USA). The gene expression were measured by real-time quantitative PCR utilizing QuantiNova™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany) on the CXF96 PCR system (Bio-Rad, Hercules, CA, USA). The primer sequences were as follows in Table S1. GAPDH and U6 were served as internal control.
5
Quantifying Gene Expression in Glioma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the brain tissues and glioma cells by using TRIzol reagent (Ambion, life technologies) as previously described.16 Then, the RNA was used to synthesize first strand cDNA with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). RT‐qPCR was conducted using QuantiNova™ SYBR® Green PCR Kit (Qiagen) protocol with Bio‐Rad CXF96 PCR system (Bio‐Rad). Each sample was performed in triplicate and the expression of the target gene was normalized to GAPDH which served as internal control. The relative gene expression was calculated with the comparative cycle threshold (2−ΔΔCt) method. Primer sequences for qPCR: KLHDC8A Forward, TGTGACCCTGGACAACCACT; KLHDC8A Reverse, GTCGAACACGTCCATCGTCC; LDHA Forward, CAG CCCGATTCCGTTACCTAATGG; LDHA Reverse, TCCACTCCATACAGGCAC ACTGG.
6
Quantitative Analysis of Chondrogenic Markers
7
Quantifying Chondrogenic Markers in Zonal Cartilage
8
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Ambion, Life Technologies, CA, USA) was used for total RNA extraction from the tissues or cells according to the manufacturer's protocol described previously [21 (link)]. The RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Lithuania, USA) was used for RNA reverse transcription. Real-time quantitative PCR was performed according to the instructions of QuantiNova™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany) using the Bio-Rad CXF96 PCR system (Bio-Rad, Hercules, CA, USA). The relative gene expression of VPS25 was calculated using the 2−ΔΔCt method. GAPDH served as an internal control. The primers were synthesized by Sangon Biotech (Shanghai, China). VPS25: F-5′-TGGTGCTCGCTGGTCCTGT C-3′, R-5′-GGACTTGCTCTTATCCAACCACTCG-3′. METTL3: F-5′-TCAGCATC GGAACCAGCAAAG-3, R-5′-TCCTGACTGACCTTCTTGCTC-3′. METTL14: F-5′-GTTGGAACATGGATAGCCGC-3, R-5′-CAATGCTGTCGGCACTTTCA-3′. YTHDC1: F-5′-AGGGATCCTGAAAGGAGGGC-3, R-5′-CACTGCTGCCAGTCTC ATGG-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!