Target clone

Manufactured by Toyobo

Sourced in Japan

TArget Clone is a laboratory instrument used for the controlled and efficient amplification of DNA sequences. It functions by employing a proprietary thermal cycling process to facilitate the Polymerase Chain Reaction (PCR) technique, a fundamental tool in molecular biology and genetics research.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy minelute cleanup kit, by Qiagen (1 mentions) Kod plus mutagenesis kit, by Toyobo (1 mentions) Sv total rna isolation system, by Promega (1 mentions) High capacity cdna archive kit, by Thermo Fisher Scientific (1 mentions) In fusion, by Takara Bio (1 mentions) Ez dna methylation gold kit, by Zymo Research (1 mentions) Ez dna methylation gold, by Zymo Research (1 mentions) Takara ex taq, by Takara Bio (1 mentions) Genejet genomic dna purification kit, by Thermo Fisher Scientific (1 mentions) Taq plus master mix, by Vazyme (1 mentions) Escherichia coli jm109, by Nippon Gene (1 mentions)

Close spelling variants of this product

TArget Clone™-Plus (3 citations) TArget™ Clone Kit (3 citations) TArget Clone -Plus- Kit (2 citations) TArget clone vector (2 citations)

6 protocols using target clone

Cloning and Mutagenesis of AKR1A1 from Human Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA derived from a human postmortem brain tissues was prepared using the SV Total RNA Isolation System (Promega), cleaned with an RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. A High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, California) was used for reverse transcription of total RNA to first-strand cDNA synthesis according to the supplier’s protocols.
Full-length AKR1A1 was cloned from the cDNA library using hAKR1A1_fw and hAKR1A1_rv primers (Supplementary Table S2). The amplified products were inserted into the pTA2 vector using TArget Clone (Toyobo). AKR1A1 mutants, c.753G > A and c.264delC, were produced using pTA2_AKR1A1 as a template with the KOD-plus-Mutagenesis Kit (Toyobo). AKR1A1_c.753_fw1 and rv1 primers were used for the c.753G > A mutant, and AKR1A1_c.264_fw1 and rv1 primers were used for the c.264delC mutant (Supplementary Table S2). Moreover, to delete the extra sequence below the new termination codon caused by the frameshift mutation, the c.753G > A and c.264delC mutants were amplified using the primer sets AKR1A1_c.753/c.264_fw2 and AKR1A1_c.753_rv2 and AKR1A1_c.264_rv2, respectively, and then self-ligated.

Iino K., Toriumi K., Agarie R., Miyashita M., Suzuki K., Horiuchi Y., Niizato K., Oshima K., Imai A., Nagase Y., Kushima I., Koike S., Ikegame T., Jinde S., Nagata E., Washizuka S., Miyata T., Takizawa S., Hashimoto R., Kasai K., Ozaki N., Itokawa M, & Arai M. (2021). AKR1A1 Variant Associated With Schizophrenia Causes Exon Skipping, Leading to Loss of Enzymatic Activity. Frontiers in Genetics, 12, 762999.

+ Open protocol

+ Expand

Construction of pCMV Expression Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pCMV donor vectors carrying Gtf2i β/δ or HTRA1 were constructed by PCR and TA-cloning with TArget Clone (Toyobo). For the construction of the pCMV-flag Gtf2i or pCMV-Myc HTRA1 vector, the flag sequence was added by PCR and In-Fusion cloning (Takara). The primers are listed in Table S4.

Pan Y., Iejima D., Nakayama M., Suga A., Noda T., Kaur I., Das T., Chakrabarti S., Guymer R.H., DeAngelis M.M., Yamamoto M., Baird P.N, & Iwata T. (2021). Binding of Gtf2i-β/δ transcription factors to the ARMS2 gene leads to increased circulating HTRA1 in AMD patients and in vitro. The Journal of Biological Chemistry, 296, 100456.

+ Open protocol

+ Expand

Bisulfite Sequencing for DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA extracted from frozen liver tissues or cultured cells was subjected to bisulfite conversion using the EZ DNA Methylation‐Gold Kit (Zymo Research, Irvine, CA). The relevant DNA segments of Line1, the differentially methylated regions (DMRs) of the Igf2 gene, were amplified from the bisulfite‐treated genomic DNA by PCR. The primers used in the bisulfite PCR are shown in Supporting Table S2. The products were analyzed by agarose gel electrophoresis, and the specific bands were excised and purified. Following reamplification, the products were inserted into a plasmid and cloned into competent cells using the TArget Clone (TAK‐101; TOYOBO, Osaka, Japan). At least 10 colonies were picked, plasmid DNA was purified from the competent cells, and sequencing of the inserted products was performed using a primer (5′‐CAGCTATGACCATGATTACG‐3′).

Watanabe K., Yamamoto M., Xin B., Ooshio T., Goto M., Fujii K., Liu Y., Okada Y., Furukawa H, & Nishikawa Y. (2019). Emergence of the Dedifferentiated Phenotype in Hepatocyte‐Derived Tumors in Mice: Roles of Oncogene‐Induced Epigenetic Alterations. Hepatology Communications, 3(5), 697-715.

+ Open protocol

+ Expand

Bisulfite Sequencing of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sonicated and heat-denatured genomic DNA was applied to bisulfite conversion using the EZ DNA Methylation-Gold™ (Zymo Research, Irvine, CA, USA). The DNA was amplified with KOD -Multi & Epi-^® (TAKARA BIO, Shiga, Japan) using the primer sets using the primers listed in S1 Table. This PCR product was amplified once with Takara Ex Taq^® (TAKARA BIO, Shiga, Japan). The amplified DNA was cloned into TArget Clone™ (Toyobo, Osaka, Japan). Sequencing results were analyzed using a quantification tool for DNAme analysis, QUMA [76 (link)].

Ito T., Kubiura-Ichimaru M., Murakami Y., Bogutz A.B., Lefebvre L., Suetake I., Tajima S, & Tada M. (2022). DNMT1 regulates the timing of DNA methylation by DNMT3 in an enzymatic activity-dependent manner in mouse embryonic stem cells. PLoS ONE, 17(1), e0262277.

+ Open protocol

+ Expand

Genomic DNA extraction and sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA of each knockout cell line was extracted with a GeneJET Genomic DNA purification kit (Thermo Fisher Scientific). Primers were designed at 200 nt upstream and downstream of the cutting site on CDC20 exons. 200 ng of genomic DNA was used as a template for the amplification of the interested region by 2× Taq Plus Master Mix (Vazyme). Amplified genomic DNA was further cloned into a pTA2 vector according to the manufacturer’s instructions (TArget Clone, Toyobo). Six clones were picked and sequenced for each cell line.

Zhang Y., Young R., Garvanska D.H., Song C., Zhai Y., Wang Y., Jiang H., Fang J., Nilsson J., Alfieri C, & Zhang G. (2024). Functional analysis of Cdc20 reveals a critical role of CRY box in mitotic checkpoint signaling. Communications Biology, 7, 164.

+ Open protocol

+ Expand

Plasmid Cloning and Sequencing for 4sU-to-C Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid
cloning of the PCR-amplified samples was conducted using TArget Clone
(TOYOBO). To generate sticky ends, 1× A-attachment Mix was added
to the PCR products and incubated for 10 min at 60 °C. The PCR
products with sticky ends were ligated into plasmids with the appropriate
ratio of PCR products/pTA2 vector (1:6), 1× ligation buffer,
and T4 DNA Ligase for 30 min at 16 °C. The ligated plasmid was
transformed into Escherichia coli JM109
(Nippon Gene) via heat shock and spread on an LB plate containing
100 μg/mL ampicillin. Plasmids were extracted from 3 to 5 colonies
with an objective insert. Plasmid sequencing was conducted using an
ABI PRISM 3500xL Genetic Analyzer (Center for Gene Research at the
University of Nagoya). The base conversion rates were determined as
(number of U to C conversions)/(total number of U) × 100 for
the desired 4sU to C conversion and (number of unwanted base conversions)/(total
base number) × 100 for other mutations. P values
were calculated using a two-tailed Student’s t test with two groups.

Ohashi S., Nakamura M., Acharyya S., Inagaki M., Abe N., Kimura Y., Hashiya F, & Abe H. (2024). Development and Comparison of 4-Thiouridine to Cytidine Base Conversion Reaction. ACS Omega, 9(8), 9300-9308.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!