Pcdna3.1 2xflag srebp1c

pcDNA3_GRIM-19 was constructed to overexpress GRIM-19. The GRIM-19 gene was amplified by PCR with GRIM-19-specific primers (GRIM-19-HindIII-F, 5′-CCCAAGCTTACCATGGCGGCGTCAAAGGTG-3′ and GRIM-19-EcoR I-R, 5′-CGGAATTCTTACGTGTACCACATGAAGCCG-3′) using cDNAs that were reverse transcribed using random primers from RNA extracted from Huh7 cells. The PCR products were cut with HindIII and EcoRI and inserted into a pcDNA3 vector (Invitrogen) in frame. To evaluate the efficiency of transfection with foreign gene-encoding plasmid in Huh7 cells, pEGFP-C1_GRIM-19 was constructed. The GRIM-19 gene was amplified by PCR with GRIM-19-specific primers (GRIM-19- BglII, GGAAGATCTATGGCGGCGTCAAAGGTGAAG and GRIM-19-EcoRI-R) as described above. The PCR products were cut with BglII and EcoRI and inserted into the pEGFP-C1 vector (Clontech Laboratories, Mountain View, CA, USA) in frame. pcDNA3_EGFP was kindly provided by Dr. Sean B. Lee (Tulane University, New Orleans, LA, USA). pcDNA3.1-2xflag-SREBP1c was purchased from Addgene (Cambridge, MA, USA).

In brief, Hepa1–6 and HepG2 cells seeded in a 6-well or 12-well plate were transfected using Lipofectamine® 3000 transfection reagent (Invitrogen, CA, USA) according to the manufacturer’s protocol. The following plasmids were used: pCMV-Flag-NS5A, pcDNA3.1-2xFlag-SREBP-1c and pcDNA3.1 AMPKα1 and α2 (from Addgene). AMPK activator 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR) was added when indicated [28 (link)]. After transfection and/or pharmacological intervention as indicated in the figure, the cells were subjected to qRT-PCR, Western blotting and Oil Red O staining.