Insectexpress medium

Manufactured by Lonza

InsectExpress medium is a specialized culture medium designed for the growth and maintenance of insect cells. It provides the necessary nutrients and support for the in vitro cultivation of various insect cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Protease inhibitor cocktail, by Roche (1 mentions) Benzonase, by Merck Group (1 mentions) Fugene hd reagent, by Promega (1 mentions) Anti v5, by Thermo Fisher Scientific (1 mentions) Simplyblue safestain, by Thermo Fisher Scientific (1 mentions) Precision plus protein dual color standard, by Bio-Rad (1 mentions) Effectene, by Qiagen (1 mentions) 3 kda filter, by Merck Group (1 mentions) Silverquest silver staining, by Thermo Fisher Scientific (1 mentions) Talon column, by Takara Bio (1 mentions) Ni nta resin, by Qiagen (1 mentions)

Spelling variants of this product

InsectExpress (4 citations)

4 protocols using insectexpress medium

Production of Influenza Virus-Like Particles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell culture and VLP production were performed as described by Carvalho et al.28 Briefly, High Five Cells were cultured in Insect‐EXPRESS™ medium (Lonza, Basel, Switzerland) and infected with recombinant baculovirus (kindly provided by Redbiotec AG) encoding for hemagglutinin subtype H1 from Influenza A/Brisbane/59/2007 and M1 protein from A/California/06/2009 virus strains. Infection was performed at a cell concentration (CCI) of 2 × 10⁶ cells per mL, with a multiplicity of infection (MOI) of 1 IP per cell. Baculovirus titers were determined by MTT cell viability assay.36, 37 One tablet per 50 mL of cell culture of EDTA‐free Protease Inhibitor Cocktail (05056489001, Roche Diagnostics, Germany) and 50 U mL^‐1 of Benzonase® (101654, Merck Millipore, Germany) were added to the cell culture approximately 12 h before harvest. Cells were harvested at a viability of 50–60%, which corresponds to approximately 48 h post‐infection. Clarification was performed by sequential depth filtration using a D0HC filter (MD0HC23CL3, Merck Millipore, Germany) and an Opticap XL150 Capsule with 0.5/0.2 µm pore size (KHGES015FF3, Merck Millipore, Germany). Clarified material was aliquoted and stored at −80 °C.

B Carvalho S., Fortuna A.R., Wolff M.W., Peixoto C., M Alves P., Reichl U, & JT Carrondo M. (2017). Purification of influenza virus‐like particles using sulfated cellulose membrane adsorbers. Journal of Chemical Technology and Biotechnology, 93(7), 1988-1996.

+ Open protocol

+ Expand

Baculovirus Production and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacmids were isolated from E. coli DH10 EmBacY cells, as described (Bieniossek et al., 2008 ). Each bacmid was verified by PCR for the genes of interest. To make P1 virus, 6-well dishes were seeded with 1.0 × 10⁶Sf9 cells per well in 2.0 mL InsectExpress medium (Lonza). Cells were transfected with 10 μg bacmid per well, using FugeneHD reagent as described by the manufacturer (Promega). Four days post-transfection, cells were checked for fluorescence, conditioned medium was harvested, diluted 1:1 with fresh medium containing 20% FBS and 0.2 μm-filtered. P1 virus was stored at 4°C in the dark. P2 (amplified) virus was prepared by infecting suspension cultures of Sf9 cells at 2.0 × 10⁶/mL with 1% v/v P1 virus and incubating for 3–4 days (140 rpm, 27°C). Cells were checked for fluorescence, pelleted by centrifugation (1000 × g, 5 min) and supernatant was 0.2 μm-filtered. Large-scale expression cultures were then set up by infecting 4–12 L suspension cultures of Sf9 cells at 2.0 × 10⁶/mL with 1% v/v P2 virus. Following incubation (140 rpm, 27°C), cells were harvested by centrifugation (1000 × g, 10 min, 4°C) 48 hours post-infection, washed in ice-cold PBS and snap frozen in liquid nitrogen. Pellets were stored at −80°C.

Hill C.H., Boreikaitė V., Kumar A., Casañal A., Kubík P., Degliesposti G., Maslen S., Mariani A., von Loeffelholz O., Girbig M., Skehel M, & Passmore L.A. (2019). Activation of the Endonuclease that Defines mRNA 3′ Ends Requires Incorporation into an 8-Subunit Core Cleavage and Polyadenylation Factor Complex. Molecular Cell, 73(6), 1217-1231.e11.

+ Open protocol

+ Expand

Cloning and Expression of Tick and Mosquito Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cloning of tick proteins, cDNA from ticks fed for 48 hours was produced as described above. The transcript was cloned into pMT/V5-His A using primers specific to the gene (Table 4). The resulting plasmid (Table 1) was transfected into Drosophila S2 cells using Effectene (Quiagen). For expression, cells were grown in Insect Express medium (Lonza) and induced by addition of copper sulfate (500 μM). The cell supernatant was collected after 7 days and the protein was purified using a Talon column (Clontech). The eluted protein was concentrated using a 3 kDa filter (Millipore) and checked by Western blot with anti-V5 (Thermo Fisher Scientific) and anti-His (Thermo Fisher Scientific) antibodies. Mosquito protein AAEL010228 was produced and purified from S2 cells similarly (Table 1, S5). Mosquito RNA was extracted from salivary glands of Aedes aegypti mosquitoes and used to produce cDNA for cloning. Gels of the purification can be seen in Figure S3. Gels were run with the Precision Plus Protein Dual Color Standards (Bio-Rad), and stained with either Simply Blue Safe Stain (Thermo Fisher Scientific) or SilverQuest Silver Staining (Invitrogen).

Murfin K.E., Kleinbard R., Aydin M., Salazar S.A, & Fikrig E. (2019). Borrelia burgdorferi chemotaxis toward tick protein Salp12 contributes to acquisition. Ticks and tick-borne diseases, 10(5), 1124-1134.

+ Open protocol

+ Expand

Recombinant Bovine CD14 Purification

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stimulation assays were performed as described previously [26 (link)]. CXCL8 production by PS cells was quantified by sandwich ELISA with reference to standard as described previously [27 (link)]. Response was also analysed by quantitative real-time PCR as described before [28 (link)]. Recombinant bovine CD14 was purified from S2 cells transfected with plasmid pCG11. The CD14 cDNA was obtained by RT-PCR from RNA of bovine blood monocytes using primers GTTGAGATCTGACACAACAGAACCCTGCGA and AGTATTCGAACGCGAAGCCTCGGGCTCCTT and cloned downstream of a BiP signal sequence and upstream of a 6-His tag in the BglII/BstBI sites of plasmid pMT-puro [29 (link)]. This plasmid was then transfected in S2 cells grown in InsectExpress medium (Lonza) without serum. After puromycin selection (1μg/ml) of transfected cells, expression of CD14 was induced by 500μM CuSo4. Purification from 1L of supernatant 6 days after induction was achieved by affinity chromatography on Ni-NTA resin (Qiagen). Purification was verified by SDS-PAGE and, after silver staining of gels, purity was estimated to be >99%. Sequence of the purified rbCD14 was confirmed by mass-spectrometry and comparison to the bovine CD14 sequence (139 peptides obtained yielding a coverage of 89%). No significant match to Drosophila melanogaster database was obtained.

Roussel P., Porcherie A., Répérant-Ferter M., Cunha P., Gitton C., Rainard P, & Germon P. (2017). Escherichia coli mastitis strains: In vitro phenotypes and severity of infection in vivo. PLoS ONE, 12(7), e0178285.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!