ESC or EBs treated with DMSO or luteolin were lysed using TRIzol. RNA was extracted by chloroform phase separation followed by precipitation with isopropanol and ethanol washes before dissolving in water. cDNA was synthesized using oligo (dT) and Moloney murine leukemia virus reverse transcriptase (Sigma). Expression analysis was performed using SYBR green mix (Bioline SensiFAST SYBR NO-ROX). Primers used for Sox1: FP: TCAAACGGCCCATGAACGCCTTC; RP: TCCGGGTGCTCCTTCATGTGC; Pax6: FP: AACGATAACATACCAAGCGTGT; RP: GGTCTGCCCGTTCAACATC; Oct4: FP: TCCTGGAGGGCCAGGAATCGG; RP: CATCGGAGTTGCTCTCCAC; Sox17: FP: CCGATGAACGCTTTCATGGTGTG; RP: CTCCACCCGCTTCAGCCGCTTC; Tbx2: FP: CTGCACGTCTCGGCACTGGGCC; RP: CCGCTGACTCGCACCTTGAAGG.
Moloney murine leukemia virus reverse transcriptase
Manufactured by Merck Group
Sourced in Italy
Moloney murine leukemia virus reverse transcriptase is an enzyme used in molecular biology applications. It catalyzes the reverse transcription of RNA into complementary DNA (cDNA).
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Nanodrop spectrophotometer, by Euroclone (3 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sensifast sybr hi rox, by Meridian Bioscience (2 mentions)
Random hexamer oligonucleotides, by Thermo Fisher Scientific (2 mentions)
Sybr green supermix, by Ozyme (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sensifast sybr no rox, by Meridian Bioscience (1 mentions)
Sybr green jumpstart taq readymix, by Merck Group (1 mentions)
Stepone software, by Thermo Fisher Scientific (1 mentions)
Primer express software, by Thermo Fisher Scientific (1 mentions)
Abi steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Merck Group (1 mentions)
Rest 2009, by Qiagen (1 mentions)
Sybr green supermix, by Roche (1 mentions)
Deoxyribonuclease, by Merck Group (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Abi prism 7700 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green 1, by Thermo Fisher Scientific (1 mentions)
14 protocols using moloney murine leukemia virus reverse transcriptase
1
Transcriptional Profiling of Stem Cells
2
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total RNA from cells with a Trizol reagent (Invitrogen, Thermo Fisher, Waltham, MA, USA) following the manufacturer’s instructions [29 (link)]. We used a Nanodrop spectrophotometer (EuroClone, Milan, Italy) to check RNA yield and purity, and MoloneyMurine Leukemia Virus Reverse Transcriptase (Sigma-Aldrich) to transcribe the total RNA into cDNA from each sample. Using SensiFAST SYBR Hi-Rox (Bioline, LABGENE SCIENTIFIC SAZI, Châtel-Saint-Denis, Switzerland), we performed Real-time PCR on a StepOne™ Real-Time PCR System (Thermo Fisher, Waltham, MA, USA). To quantify gene expression, we used the comparative Ct method (DDCt), and the relative quantification was estimated as 2-∆∆Ct. Melting curve analysis excluded the presence of non-specific amplification products. The forward and reverse primer sequences are shown in Table 1 .
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA was carried out using RNA STAT-60 reagent for guanidinium thiocyanate–phenol–chloroform extraction (AMS Biotechnology, Abingdon, UK), following the manufacturer’s recommended protocol. Any potential DNA contaminations were eliminated from the extracted RNA by DNase I treatment (Invitrogen, Carlsbad, CA) prior to cDNA synthesis. The DNase I–treated RNA was used for first-strand cDNA synthesis by Moloney murine leukemia virus reverse transcriptase (Sigma-Aldrich). Changes in gene expression were determined by real-time polymerase chain reaction with the ABI StepOne Plus Real-Time PCR system (Applied Biosystems, Foster City, CA) using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich). Primer Express software (Applied Biosystems) was used to design specific primers for each gene. Sequences of the gene-specific primers are listed in Table 1 . The resulting data were analyzed using StepOne software (version 2.3; Applied Biosystems). All primers were tested for efficiency, and the comparative cycle threshold method was used to analyze the relative changes in gene expression. Cycle threshold values for all target genes were normalized to constitutively expressed ribosomal protein L19 and also to glyceraldehyde 3-phosphate dehydrogenase for amnion and myometrial cells, respectively.
4
RNA Extraction, RT-qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells with a Trizol reagent (Invitrogen, Thermo Fisher, Waltham, MA, United States) according to the manufacturer’s instructions [46 (link)]. RNA yield and purity were checked using a Nanodrop spectrophotometer (EuroClone, Milan, Italy), and total RNA from each sample was reverse transcribed into cDNA using Moloney Murine Leukemia Virus Reverse Transcriptase (Sigma-Aldrich). Real-time PCR was performed on a StepOne™ Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) using SensiFAST SYBR Hi-Rox (Bioline, LABGENE SCIENTIFIC SAZI, Châtel-Saint-Denis, Switzerland). The comparative Ct method (ΔΔCt) was used to quantify gene expression, and the relative quantification was calculated as 2−ΔΔCt. The presence of non-specific amplification products was excluded by melting curve analysis. Statistical analyses on real-time PCR data were performed using the Relative Expression Software Tool (REST2009, Qiagen, Venlo, The Netherlands) [47 (link)]. The forward and reverse primer sequences are shown in Table 1 .
5
Luteolin-Induced Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Was performed as described earlier in [6 (link)]. Briefly, following treatment with luteolin, total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized with oligo(dT) (28-mer) (Invitrogen) and Moloney murine leukemia virus reverse transcriptase (Sigma), and expression analysis was carried out using SYBR Green supermix (Kapa) and gene-specific primers.
6
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed with Trizol reagent (Invitrogen Life Technologies) according to manufacturer's guidelines. RNA (1 μg) was used for cDNA synthesis according to the manufacturer's protocols using the Moloney murine leukemia virus reverse transcriptase (Sigma) with random hexamers (Invitrogen) after treatment with deoxyribonuclease (Sigma). Synthesized cDNA was then used for Q-RT-PCR using SYBR Green I (Life Technologies) according to manufacturer's instructions. Thermocycling was performed on an ABI PRISM 7700 Sequence Detection System (Life Technologies). Fold changes were calculated by the ΔΔCt method using L19 as a housekeeping gene (25 (link)). PCR primers used in this study are listed in Supplemental Table 1 published on The Endocrine Society's Journals Online web site at http://mend.endojournals.org .
7
Quantitative Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by Trizol reagent (Invitrogen) according to the manufacturer’s instructions (33 (link)). RNA yield and purity were checked using a Nanodrop spectrophotometer (EuroClone), and total RNA from each sample was reverse transcribed into cDNA using Moloney Murine Leukemia Virus Reverse Transcriptase (Sigma-Aldrich). Real-time PCR was performed on a StepOne™ Real-Time PCR System (Thermo Fisher) using SensiFAST SYBR Hi-Rox (Bioline). The comparative Ct method (ΔΔCt) was used to quantify gene expression, and the relative quantification was calculated as 2−ΔΔCt. The presence of non-specific amplification products was excluded by melting curve analysis. Statistical analyses on real-time PCR data were performed using the Relative Expression Software Tool (REST) (34 (link)). The forward and reverse primer sequences were reported in Table 1
8
Quantifying GLUT1 mRNA Expression in Vascular Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For GLUT1 mRNA quantification, total RNA was extracted from vascular cells after 18 h of treatment using a commercial kit (RNeasy, Qiagen; Crawley, UK) and quantified by absorbance at 260 nm. Aliquots of 1 µg RNA were reverse-transcribed using Moloney murine leukemia virus-reverse transcriptase (Sigma). The resulting cDNA was amplified using a human GLUT1 gene-specific relative RT-PCR kit (Ambion, Austin, TX, USA) containing an 18S internal standard, according to the manufacturer’s instructions. The reaction was conducted in a Peltier PTC100 thermocycler (M&J Research, Waltham, MA, USA) with an initial denaturation step at 95 °C for 3 min, followed by 23 cycles each consisting of incubation at 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 30 s. Aliquots of the resulting PCR were loaded on 2 % agarose gels containing ethidium bromide, the resulting bands were visualized under ultraviolet light and quantified using NIH Image free software.
9
RT-qPCR for Gene Expression Analysis
10
Quantitative Analysis of C-P4H Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!