Hifair first strand cdna synthesis kit

Total RNAs were extracted from control and SPc nanoparticles exposed third instar larvae using TRIeasy (Yeasen Biotech, Shanghai, China). The cDNAs were synthesized by the Hifair First Strand cDNA Synthesis Kit (Yeasen Biotech) and used as templates for PCR experiments using the Perfect Start Green qPCR Super Mix (TransGen Biotech, Beijing, China). qRT-PCR were conducted on an ABI QuantStudio 6 Flex System (Thermo Fisher, USA). The Rpl32 gene was used as internal control for qRT-PCR, and the gene expression level was examined by the ΔΔCt method [88 (link), 92 (link)]. The primers used for qRT-PCR in this study are listed in Additional file 6: Table S2.

Total RNA was extracted from ovaries, pooled oocytes (n = 50), and pooled embryos (n = 50) using TRIzol reagent (Invitrogen, USA) according to the instructions. Hifair First Strand cDNA synthesis kit (Yeason, China) was used for reverse transcription reaction. SYBR Green Master Mix (Yeason, China) was used for quantitative PCR (Quantagene q225 qPCR system). mRNA levels of genes were normalized to Gapdh. Each experiment was repeated at least three times independently. The primers used are shown in Table S1, Supporting Information.

Total RNA (2 µg) was reverse transcribed into cDNA using the Hifair^® First Strand cDNA Synthesis Kit (Yeasen, 11139ES60). The qPCR method was performed using Hieff^® qPCR SYBR Green Master Mix Reagent (Yeasen), and the reactions were performed under the conditions specified by the manufacturer. Relative mRNA expression was normalized by GAPDH as gene expression, and calculated by 2^−ΔΔCt method. The primers used include: GADPH, 5′-GGAGCGAGATCCCTCCAAAAT-3′(forward) and 5′-GGCTGTTGTCATACTTCTCATGG-3′ (reverse); CD44, 5′-CCCTGCTACCAGAGACCAAGAC-3′(forward) and 5′-GCAGGTTCCTTGTCTCATCAGC-3′ (reverse); PD-L1,5′‐CCAAGGCGCAGATCAAAGAGA‐3′ and 5′‐AGGACCCAGACTAGCAGCA‐3′.