Genelute total rna purification kit

RNA was isolated using GenElute™ Total RNA Purification Kit (Sigma-Aldrich, MO, USA). For genomic DNA removal, TURBO DNA free kit (Thermo Fischer, USA) was used according to the manufacturer’s instructions. cDNA synthesis was performed using an iScript Advanced cDNA synthesis kit (Bio-Rad Laboratories, CA, USA) according to the manufacturer’s instructions using a mixture of oligo-dT and random hexamer primers. Subsequently, reverse transcriptase-PCR (RT-PCR) was carried out from the synthesized cDNA using primers listed in the Additional file 1: Table S4 that can amplify ~ 200 base pair amplicons. PCR was performed with 30 cycles: 30 s at 95 °C; annealing: 45 s at 60 °C; and extension 60 s at 72 °C. The PCR products were loaded on the 1.2% agarose gel and visualized under UV trans-illuminator.

RNA was isolated using the GenElute Total RNA Purification Kit (Sigma Aldrich, Castle Hill, Australia) and treated with DNase using the Turbo DNA-free kit (Ambion, TX, USA). The amount, integrity and purity of the RNAs were assessed using the Experion Automated Electrophoresis System (Bio-Rad, CA, USA). The absence of genomic DNA contamination from P. gingivalis and T. denticola in the RNA sample was determined by performing PCR on RNA samples using TDE0762 (forward: GGCTCCGAATCAAAACGATA, reverse: CTATCGACTCCCCGTTTTCA) and PG0719 (forward: GCATTGCAGCATAGCGAATA, reverse: GCCGATGGAAAAAGTGTGTT) primer pairs respectively while the respective genomic DNAs were used as positive controls.

The effect of the EO on the expression of L. monocytogenes virulence genes was investigated using real time RT-PCR. Strains were grown in presence of EO at 30°C in TSB, and total RNA was extracted using GenElute total RNA Purification kit (Sigma Aldrich). cDNA synthesis was performed using the Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany) and synthesized cDNA was used as the RT-qPCR template. The amplification product was detected using SYBR Green reagents (SYBR Green JumpStar Taq ReadyMix, Sigma Aldrich) by Rotor-Gene (Qiagen). The primers for each gene are reported in Table 2. Data were normalized to the endogenous control (16S rRNA) and the level of candidate gene expression between treated and untreated samples was compared to study relative gene expression and the effect of EO on each gene.

Tissues were obtained and total RNA was extracted using GenElute Total RNA Purification Kit (Sigma-Aldrich; Merck KGaA, Beijing, China). Then, the concentration and quality of total RNA were analyzed using NanoDrop 2000 (Thermo Fisher Scientific, Inc., Shanghai, China). Reverse transcription was performed using RNA with (OD260)/OD280 (260 Nm) close to 2.0. The SuperScript® Vilo cDNA Synthesis Kit (Invitrogen, CA, USA) was used for reverse transcription with 2 μg of total RNA. The levels of MPC1, COX6C, CYB5R3, CASP7, and CYCS were quantified using the SYBR green I Master Mix Kit (Invitrogen; Thermo Fisher Scientific, Inc., Shanghai, China) through quantitative real-time PCR (qPCR). The 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc., Shanghai, China) was used for qPCR according to the manufacturer’s instructions, with GAPDH serving as the endogenous control for mRNA qPCR was performed under thermal cycling conditions: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 20 s, 60°C for 15 s, and 72°C for 20 s. Final gene expression was calculated using the 2^−ΔΔCT method. The primer sequences are detailed in Table 1.

Extractions of RNA were performed after cells were collected utilizing the GenElute Total RNA Purification Kit (Sigma‐Aldrich; Merck KGaA). Reverse transcription of total RNA (2.0 μg) was performed with SuperScrip®Vilo cDNA synthesis kit (Invitrogen). The comparative overexpression of SNHG15, miR‐153‐3p, and ATG5 were determined employing qPCR with a SYBR green I Master Mix kit (Invitrogen; Thermo Fisher Scientific, Inc.) in a 7500 real‐time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The methods followed what was laid forth in the kit's manual. U6 was the intrinsic control of miR‐153‐3p. GAPDH was the intrinsic control of SNHG15 and ATG5. The following cycling procedure was used for qRT‐PCR: initial denaturation, 95°C, 10 min; 95°C, 20 s, 60°C, 15 s and 72°C, 20 s; 40 cycles. Expression was quantified using the formula 2 −ΔΔCq. Primer sequences: SNHG15:Forward primer: 5′‐CAACCATAGCGGTGCAACTGTGC‐3′, Reverse primer: 3′‐GGCTGAACCAAGTTGCAAGTCATG‐5; miR‐153‐3p:Forward primer: 5‐GTCAATTGAGCACGTGGC‐ CAC‐3; Reverse primer:5‐GACGTACGGACTGACGGACCAC3; ATG5:Forward primer: CACCGAGTGGATAATCTTTATGGCA Reverse primer:AAACTGCCATAAAGATTATCCACTC; U6:Forward primer:GGAAGTAGCACCTGATTAGC Reverse primer:TTGGAATACGAATIGGCCG; GAPDH:Forward primer:CTCACCGGATGCACCAATGTT Reverse primer:CGCGTTGCTCACAATGTTCAT.

GenElute™ Total RNA Purification Kit (Sigma‐Aldrich, USA) was employed to isolate total RNA from tissue or cells. In an effort to determine mRNA expression of LINC00857 and NEK2, PrimeScript™ RT kit (TaKaRa, Japan) was introduced for synthesis of cDNA. For miR‐486‐5p, reverse transcription was completed by miScript reverse transcription kit (Qiagen GmbH, Germany). Quantification was completed by qRT‐PCR analysis kit (Thermo Fisher Scientific, USA). GAPDH was applied as endogenous control of LINC00857 and NEK2, and U6 as endogenous control of miR‐486‐5p. The 2^−ΔΔCt method was utilized to compute relative gene levels normalized by GAPDH and U6. Primer sequences are listed in Table 1.

Total RNA was extracted from cells using GenElute Total RNA Purification Kit (Sigma) and possible DNA contamination was eliminated with RNase free DNase kit (QIAGEN). Total RNA (500 ng) was used for first-strand cDNA synthesis with Superscript IV (Invitrogen). qPCR was performed on StepOne Plus RT-PCR System using DreamTaq HS polymerase (Thermo Scientific), and gene expression was normalized to that of GAPDH. Poly(A)-tail length assay was carried out using USB® Poly(A) Tail-Length Assay Kit (Thermo Scientific) as instructed. PCR products were resolved on 3% agarose gel and lane intensity was plotted in arbitrary units using Plot Profile function of ImageJ.