Yeast extract peptone dextrose agar

Chitosan (CS), with an average molar mass of 290 kDa and 81.6% deacetylation degree (as previously determined by viscometry, respectively by NMR analysis [19 (link)]) was provided by Merck Chemical (Saint Louis, MO, USA). L-(+)-Lactic acid (LA) and anhydrous glycerin (Gly) were purchased from Chemical Company (Iași, Romania). Nystatin (NYS) drug, internationally qualified by USP Reference Standard, with particle sizes under 50 µm (Figure S1 in Supplementary Materials) was supplied by Antibiotice SA, Iași, Romania. Aqueous Propolis 30% (w/v) (PRO) with 7.72 mg/mL polyphenols and 0.26 mg/mL flavones/flavonoids contents (spectrophotometrically determined according to Singleton et al., 1999 [20 (link)] at APHIS-DIA Laboratory, Cluj-Napoca, Romania) was purchased from Dapis Transilvania (Cluj-Napoca, Romania). All the analytical grade chemicals were used as received. Candida albicans ATCC 90028 and Candida glabrata ATCC 90030 were provided by American Type Culture Collection (Manassas, VA, USA). Yeast Nitrogen Base Agar with dextrose and Yeast Extract Peptone dextrose Agar (YPD) were purchased from Merck Chemical (Saint Louis, MO, USA), while Sabouraud dextrose agar (SDA) was acquired from Biokar Diagnostics (Allonne, France).

The yeast strain used in this study was originally isolated from the intestine of zebrafish (AB strain) that were reared in a recirculating system (Pentair Aquatic Eco-Systems, NC, USA) at Nord University, Bodø. The isolated yeast colonies were identified by PCR amplification and Sanger sequencing of the internal transcribed spacer 2 (ITS2) region of the fungal rDNA, using fITS7 (GTGARTCATCGAATCTTTG) and ITS4 (TCCTCCGCTTATTGATATGC) primers (23 (link), 24 (link)). Identification at the species level was determined by BLASTN similarity searches against the National Centre for Biotechnology Information (NCBI) GenBank database using default parameters. Pure yeast cultures were prepared and stored in 30% (v/v) glycerol (Sigma-Aldrich, St. Louis, MO, United States) at −80°C. Prior to use in the exposure studies, the cultures were revived on yeast extract peptone dextrose agar (Sigma-Aldrich) plate and broth supplemented with 0.025% chloramphenicol (Sigma-Aldrich). A single colony from the agar plate was inoculated and further grown in yeast extract peptone dextrose broth at 28°C, shaking the culture flasks at 180–200 rpm for 24 h. The cultured yeast cells were then harvested by centrifugation at 10,000 rpm for 10 min, washed and resuspended in sterile phosphate-buffered saline (PBS, Sigma-Aldrich) to a final concentration of 2 × 10⁵ CFU/ml for the exposure study.