Affinity-purified Antibodies against total and Ser886 and Ser999 phospho-sites of EPRS were generated as described7 (link),31 (link). Antibody against phospho-Ser was from Meridian Life Science. Antibodies specific for the C-terminus of S6K1 and N-terminus of S6K2 were purchased from Abcam and LifeSpan, respectively. Antibodies against PKA, DMPK, PKN, GAPDH, caveolin1, CD36/FAT, GLUT4, His-tag, β-actin and FATP1, FATP3, and FATP4 were from Santa Cruz. Antibody specific for FABP4 and FABP5 were from R&D and for FABPpm/GOT2 was from GeneTex. All other antibodies and rapamycin were from Cell Signaling. SignalSilence siRNAs targeting RSK1, AKT and S6K1 were from Cell Signaling, and those targeting raptor and rictor were from Santa Cruz. The 3′UTR-specific duplex siRNAs, UGAUACGAAGAUCUUCUCAG and GCCUAAAUUAACAGUGGAA, targeting mouse EPRS were from Origene. Smart pool siRNA targeting the coding sequence of mouse FATP1 (SLC27a1) was from Dharmacon and 3′UTR-specific trilencer siRNA targeting human S6K1 was from Origene.
Antibody against phospho ser
Manufactured by Meridian Bioscience
The antibody against phospho-Ser is a laboratory reagent used to detect and quantify the presence of proteins containing phosphorylated serine residues. It is a specific and sensitive tool for research applications that require the identification and analysis of serine phosphorylation events in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Smartpool sirna, by Horizon Discovery (2 mentions)
Antibodies against, by Santa Cruz Biotechnology (2 mentions)
Antibodies specific, by Abcam (2 mentions)
Signalsilence sirna, by Cell Signaling Technology (2 mentions)
Fabppm got2, by GeneTex (2 mentions)
3 utr specific duplex sirnas, by OriGene (2 mentions)
Slc27a1, by Horizon Discovery (2 mentions)
3 utr specific trilencer sirna targeting, by OriGene (2 mentions)
2 protocols using antibody against phospho ser
1
Antibody generation and siRNA targeting
2
Antibody generation and siRNA targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Affinity-purified Antibodies against total and Ser886 and Ser999 phospho-sites of EPRS were generated as described7 (link),31 (link). Antibody against phospho-Ser was from Meridian Life Science. Antibodies specific for the C-terminus of S6K1 and N-terminus of S6K2 were purchased from Abcam and LifeSpan, respectively. Antibodies against PKA, DMPK, PKN, GAPDH, caveolin1, CD36/FAT, GLUT4, His-tag, β-actin and FATP1, FATP3, and FATP4 were from Santa Cruz. Antibody specific for FABP4 and FABP5 were from R&D and for FABPpm/GOT2 was from GeneTex. All other antibodies and rapamycin were from Cell Signaling. SignalSilence siRNAs targeting RSK1, AKT and S6K1 were from Cell Signaling, and those targeting raptor and rictor were from Santa Cruz. The 3′UTR-specific duplex siRNAs, UGAUACGAAGAUCUUCUCAG and GCCUAAAUUAACAGUGGAA, targeting mouse EPRS were from Origene. Smart pool siRNA targeting the coding sequence of mouse FATP1 (SLC27a1) was from Dharmacon and 3′UTR-specific trilencer siRNA targeting human S6K1 was from Origene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!