Reverse transcriptase 3

OT-II or WT mice were sacrificed and splenic CD4⁺ T cells were isolated by negative selection (Stem Cell Technologies, Vancouver, Canada). Purified CD4⁺ T cells were stimulated on coated plates with antibodies to CD3 (1 μg/ml) and CD28 (0.5 μg/ml) (e-bioscience, San Diego, CA, USA) then skewed toward a Th1 or Th2 phenotype as described [23 (link)]. WT CD4⁺ T cells were skewed in the absence or presence of 5 μM olaparib. RNA was extracted using Qiagen RNA extraction kit according to the manufacturer instructions. The extracted total RNA was used for the generation of cDNA using reverse transcriptase III (Invitrogen) and quantitative PCR was conducted using primer sets (IDT, San Jose, CA, USA) specific for mouse gata-3, il-4, t-bet, ifn-γ, or β-actin as described [23 (link), 24 (link)]. Quantitative determination of gene expression levels using a 2-step cycling protocol was conducted on a MyIQ Cycler (Bio-Rad, Hercules, CA, USA). Relative expression levels were calculated using the 2[−Delta Delta C(T)] method [25 (link)]. Quantities of all targets were normalized to the mouse β-actin gene.
Th2-like cells from OT-II mice were administered i.v. into the tail vein of recipient mice (1 × 10⁶ cells/mouse). All mice were subjected to OVA challenge daily for 4 days. Mice were sacrificed 48 h after the last challenge.

To determine the expression of GmST1 in the transgenic Arabidopsis lines, total RNA was isolated from leaves of 3-week-old seedlings of wild type and two independent transgenic lines using TRI reagent (Sigma; St. Louis, MO, USA), following manufacture’s instruction. RT-PCR was conducted to examine the expression of GmST1 in Arabidopsis transgenic lines using primer pair of P4 and P6. After reverse transcription step (Invitrogen Reverse Transcriptase III was used), 30 cycles of PCR amplification (95°C, 30 s-60°C, 30 s-72°C, 1 min) was performed. Arabidopsis actin 1 gene was served as a loading control.

Serum and cell culture HBV viral genomic DNA was prepared with QIAampMinElute Virus Spin Kit (Qiagen). Total cellular genomic DNA was prepared using DNeasy Blood & Tissue Kit (Qiagen). Total RNA was prepared from HepG2 or HepG2-CLuc cells using RNeasy Plus Mini Kit (Qiagen). Then, the cDNA was generated using reverse transcriptase III (Invitrogen). HBV mRNA was quantified using ABsolute QPCR Mix, SYBR Green, ROX(Thermo Scientific). Primers HBc-F (GAGTGTGGATTCGCACTCC) and HBc-R (GAGGCGAGGGAGTTCTTCT) were used to measure HBV genomic DNA and pgRNA. HBx-F (TCACCAGCACCATGCAAC) and HBx-R (AAGCCACCCAAGGCACAG) were used to measure the HBV total mRNA. Q-beta-actin-F (CCATCATGAAGTGTGACGTGG) and Q-beta-actin-R (GTCCGCCTAGAAGCATTTGCG) were used to normalize the cellular total mRNA. CD4-F (CACGGGGAGTCAGCACCTTAT) and CD4-R (GGGATATGGCATCACAGCCT) were used to normalize the cellular genomic DNA.

Expression of messenger RNA for α₁-adrenergic receptors was evaluated by reverse transcription and quantitative PCR analyses. Commercially available primers and probes (TaqMan® Gene Expression Assays; Applied Biosystems, CA, USA) against α_1A- (Mm00442668_m1), α_1B- (Mm00431685_m1), and α_1D-adrenoceptors (Mm01328600_m1) were used with the transferrin receptor (Mm01344478_m1) serving as reference. Isolated arteries were disrupted in lysis buffer using Qiagen TissueLyser (Denmark). Total RNA was isolated with the RNeasy Micro QiaCube kit and—after DNase treatment—reverse transcribed using Reverse Transcriptase III (Invitrogen, CA, USA), RNase inhibitor Superase (Invitrogen), and random decamer primers (Eurofins Genomics, Germany). To control for genomic amplification, RT– experiments were performed without reverse transcriptase added. PCRs performed with a Stratagene MX3000P qPCR system (AH Diagnostics, Denmark) consisted of 1 cycle at 95 °C for 4 min followed by 50 cycles at 92 °C for 10 s, 55 °C for 20 s, and 72 °C for 30 s. Expression levels for α₁-adrenoceptors in cancer arteries relative to control arteries were calculated based on the 2^–ΔΔCt method [26 (link)].