The design and production of AAV2-shMlkl and scrambled viral particles was carried out by the VectorBuilder Inc company. The most potent and specific shRNA against Mlkl was used (mMlkl[shRNA#2]: AATTCGATTCTCCCAACATCTTGCGTATATTTGGGATTTGC; knockdown score—15). All vector concentrations were > 1012 genome copies/ml. To show that AAV2-shMlkl viral particles effectively reduce the Mlk1 levels in the RGCs, we used primary RGC cultures isolated from retinas using the two-step immunopanning protocol as described in our articles7 (link),8 (link),31 (link). To transduce RGCs with AAV2, primary neurons were plated in 24-well plates at a density of 200,000 cells per well and viral particles (5 µl) were added to the media after 1–1.5 h. RGCs were cultured in the serum-free media (Neurobasal/B27 media; ThermoFisher Scientific, US) for the next 24 h. The serum-free media was then replaced with fresh one. AAV2-treated RGCs were collected 2 days later and used in the quantitative RT-PCR. To this end, we used Mlkl-specific primers (5ʹ–ACCCTGAAGCAATGCTCACT–3ʹ, 5ʹ–TGATCAATGCAAATCCCA–3ʹ). Relative expression was calculated by comparison with a standard curve, following normalization to the housekeeping gene 18S ribosomal RNA (Rn18s) expression (5ʹ–CGGCTACCACATCCAAGGAA–3ʹ, 5ʹ–GCTGGAATTACCGCGGCT–3ʹ).
Neurobasal b27 media
Manufactured by Thermo Fisher Scientific
Sourced in United States
Neurobasal/B27 media is a cell culture medium specifically designed for the growth and maintenance of neuronal cells. It provides a defined, serum-free environment that supports the survival and differentiation of primary neurons and neuronal cell lines.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (3 mentions)
Antibiotic antimycotic, by Thermo Fisher Scientific (3 mentions)
Poly l lysine (pll), by Merck Group (2 mentions)
Papain solution, by Worthington (1 mentions)
Glutamax, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
10 protocols using neurobasal b27 media
1
AAV2-Mediated Mlkl Knockdown in Retinal Ganglion Cells
2
Immunopanning Protocol for Retinal Ganglion Cell Isolation
3
Immunopanning Protocol for RGC Isolation
4
Culturing Hippocampal Neurons from Rat
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hippocampal neurons were dissociated and maintained as described previously [65 (link)]. Briefly, neurons were taken from 18-days-pregnant Sprague–Dawley rats and maintained for 14 days in vitro (DIV) on 12-well culture plates (500,000 cells/well) coated with poly L-lysine (Sigma, West Springfield, MA, USA) and supplemented with neurobasal/B27 media (Gibco, NY, USA). The culture was placed on a shelf in a 37 °C humidified CO2 incubator and the medium was changed every 2 days. Interventional studies involving animals received ethical approval (18150-FCS-UCH, date 29 May 2018) from the University of Chile.
5
Adenoviral Infection of Cortical Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary cortical neurons were obtained from prenatal (E15) mice. Dissociated neurons were seeded at a density of 63,000 cells/cm2 on polyornithin (Sigma) precoated culture dishes and maintained in Neurobasal/B27 media (Gibco) supplemented with Glutamax (Gibco). Cells were infected with a recombinant adenovirus expressing human APP695 at a concentration of 100 pfu/cell for 6 h in DIV1 as described [68 (link)].
6
Culturing Hippocampal Neurons from Rat Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hippocampal neurons were dissociated and maintained as described before [28 (link)]. Briefly, neurons were taken from 18-day pregnant Sprague-Dawley rats and maintained for 14 days in vitro (DIV) on 12-well culture plates (500,000 cells/well) coated with poly-L-lysine (Sigma) and supplemented with neurobasal/B27 media (Gibco). The culture was placed on a shelf in a 37°C humidified CO2 incubator, and the medium was changed every 2 days.
7
Isolation and Co-culture of Retinal Ganglion Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate retinal ganglion cells (RGCs), we used the two-step immunopanning protocol [8 (link),27 (link)]. To this end, the retinas were incubated in papain solution (16.5 U/mL) for 30 minutes. Next, macrophage and endothelial cells were removed from the cell suspension by panning with the anti-macrophage antiserum (Accurate Chemical, Westbury, New York, United States). RGCs were bound to the panning plates containing anti-Thy1.2 antibody and released by trypsin incubation. Isolated primary RGCs were grown in serum-free media (Neurobasal/B27 media; Life Technologies, Grand Island, New York, United States) one day before the experiment. Astrocytes and microglial cells were obtained by the ‘shaking method’ as previously described [28 (link)]. These cells were cultured in DMEM (Life Technologies, Grand Island, New York, United States) containing 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies, Grand Island, New York, United States) one day before the experiment. Astrocytes and microglial cells were maintained during the experiment in DMEM containing 0.1% FBS. To prepare RGC/glia co-culture, RGCs were plated on cover slips in 24-well plate. Glia were plated in culture inserts and placed into the culture wells containing RGCs 24 hours prior to treatment. RGC/glia co-cultures containing 0.1% FBS were maintained during the experiment in DMEM.
8
Isolation and Culture of Retinal Ganglion Cells
9
Isolation and Culture of Primary Neural Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RGCs were isolated using the two-step immunopanning protocol as previously described (Dvoriantchikova et al., 2012 ). Isolated RGCs were cultured in serum-free basal media (Neurobasal/B27 media; Life Technologies, Grand Island, NY, USA) 1 day before the experiment. We obtained primary cortical astrocytes using the ‘shaking method’ as previously described (Barakat et al., 2012 (link)). To prepare Müller glia, we used a previously described protocol (Hauck et al., 2003 (link)). Briefly, retinas from early postnatal pups (P4-8) were digested for 30 min in papain (20 U/mL), triturated and plated onto plastic dishes. Dishes were shaken after 16 h and nonattached cells were removed. Attached Müller glial cells were grown until confluency, trypsinised and used in our study. Primary cortical astrocytes and Müller glia were cultured in Dulbecco's modified Eagle's medium (DMEM; Life Technologies), containing 10% heat-inactivated fetal bovine serum (FBS; Life Technologies) and 1% antibiotic–antimycotic (Life Technologies). RGCs, astrocytes and Müller glia were maintained during the experiment in half DMEM and half Neurobasal media containing 0.1% FBS and 1% antibiotic–antimycotic.
10
Isolation and Culture of Retinal Cell Types
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!