Patu8988

The human pancreatic cancer cells Mia PaCa-2, PL45, PATU8988, JF305, PANC-1, Panc 10.05, Panc 05.04, BxPC-3, the human bladder cancer cell T24, and the human lung cancer cell Calu-1 were purchased from iCell Bioscience Inc. (Shanghai, China) or the Cell Bank of Chinese Academy of Medical Sciences (Beijing, China). All the cell identity was validated by short tandem repeats (STR) and confirmed to be free of mycoplasma contamination. All the cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Solarbio, Shanghai, China) in a humidified incubator (Thermo Fisher Scientific, Waltham, MA) with 5% CO₂ at 37 °C.

HPDE6-C7 (EK-Bioscience Inc., STR-Identified, Shanghai, China), Patu-8988 (iCell Bioscience Inc., STR-Identified, Shanghai, China) and PNAC-1 cells (Procell Inc., STR-Identified, Wuhan, China) were cultured in DMEM (Procell, China) supplemented with 10% fetal calf serum (Gibco, USA) and 1% penicillin and streptomycin (Biosharp, China) at 37 °C in 5% CO₂. In qRT-PCR studies, the total RNA was extracted from cells. The primers were as follows: MBOAT2-fw: gcccatcgaccaggtatgc; MBOAT2-rv: cagcgagctgctccattttc; CDA-fw: caattgctatcgccagtgaca; CDA-rv: ccatccggcttggtcatgta; LPCAT2-fw: cctctggttggcagactgtt; LPCAT2-rv: tcacagtatcctggggccat; B4GALT5-fw: ctcgctgctgtacttcgtct; B4GALT5-rv: taaggatcgccaccttccac.