Anti nurr1

SH-SY5Y cells were treated with a NURR1 activator, C-DIM12 (Bio-Techne Hong Kong Ltd., Hong Kong) to induce NURR1 expression/activation. Cells were seeded at 40–50% confluency in 24-well plates 24 h before treatment. The cells were then exposed to 10 μM C-DIM12 or vehicle (0.01% DMSO) for 72 h. Total protein lysates from treated cells were extracted and quantified. Equal amounts of protein (30 μg) were electrophoresed in 10% (acrylamide/bisacrylamide 37.5:1; Bio-Rad™) SDS-PAGE gels and then transferred onto a PVDF membrane. Resulting blots were blocked with 5% non-fat skimmed milk and probed with anti-SYNGR3 (1:3000), anti-NURR1 (1:1000) or anti-β-actin (1:1000) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibodies. Blots were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000) followed by ECL substrate detection. Immunoblots were quantified by computerized scanning densitometry.
SH-SY5Y cells were transiently transfected with the pGL3-hSYNGR3–1870/ATG construct containing three NBRE-like elements. Real time luciferase activity was measured from 12 h to 36 h following treatment with vehicle and C-DIM12 (10 μM) in SH-SY5Y cells as described above.

Brain tissues containing ipsilateral SN and VTA were isolated from the mouse brain after the sacrifice at the indicated time. ChIP assays were performed using a commercial assay kit (cell signaling). Chromatin prepared from midbrain tissues containing SN and VTA regions from two animals for each group was sheared and pre-cleared. Next, chromatin was divided and immunoprecipitated overnight at 4 °C by rotation with anti-REV-ERBα (cell signaling, #13,418) and anti-NURR1 (Santacruz, sc-376984) antibody. Immune complexes were collected by incubation with protein G magnetic beads (Cell Signaling). qPCR was performed using a TaqMan™ Universal PCR Master Mix (Applied Biosystems). The primer sets used for the Taqman qPCR assay were as previously described [13 (link)]. TH up, 5′-AGA GCA GGC AGT GCA GAG TA-3′; TH dn, 5′-TTC CTG TTC CAG GAG TCT GA-3′; TH probe, 5′FAM-CCA GCT TGG CGC AGC ATC TC-3′BHQ1 for REV-ERBα; TH up, 5′-GCC GAG ACA AGA GAA CGA AT-3′; TH dn, 5′-CAG CAA CAC GAA TGT GGA TT-3′; TH probe, 5′FAM-CCT TTC GGC AAA TGT CTT ACA CTG ACA-3′BHQ1 for NURR1.

SDS-PAGE, immunoblotting, and real-time PCR analyses were performed as previously described.^{62 (link),63 (link)} Gel electrophoresis was conducted using the NuPAGE system with 4–12% pre-cast gradient gels and MES/SDS running buffer (Thermo Fisher Scientific, Waltham, MA). For human mesencephalic tissues, primary antibodies for NLRP3 were the same as described above. The following antibodies were used for cell culture lysates and immunoprecipitation assays: anti-NLRP3/NALP3 (Adipogen, San Diego, CA; Cell Signaling Technology, Danvers, MA), anti-c-Myc [9E10] (Abcam, Cambridge, MA), anti-Ubiquitin (Cell Signaling, Danvers, MA), anti-BiP (HSPA5) (Cell Signaling, Danvers, MA), anti-Nurr1 (Santa Cruz Biotechnology, Dallas, TX), anti-tyrosine hydroxylase (Abcam, Cambridge, MA), and anti-actin horseradish peroxidase (HRP)-coupled (Sigma-Aldrich, St. Louis, MO) antibodies. Immunoreactivity was detected using HRP-conjugated anti-rabbit and anti-mouse secondary antibodies (Millipore, Billerica, MA) as appropriate in combination with a chemiluminescent detection method (ECL-Plus, Thermo Fisher Scientific, Waltham, MA). NLRP3 transcripts were analyzed using real-time PCR with amplification detected using SYBR Green (Bio-Rad Laboratories, Hercules, CA), NLRP3 forward primer: CACTTCCAGTTTTTGCCGGG, and NLRP3 reverse primer: GGGAATGGCTGGTGCTCAAT.