Taqman gene specific primer fam mgb probe mixes

Cells were mock, IFN-β stimulated (100 IU/ml), or infected with HSV-1 or ΔICP0 at the indicated MOI. Total RNA was isolated at the indicated times post-treatment using the RNAeasy Plus Kit (Qiagen, 74134), according to the manufacturer’s instructions. Reverse transcription (RT) was performed using the TaqMan Reverse Transcription Reagents kit (Life Technologies, N8080234) with oligo(dT) primers. cDNA samples were analyzed in triplicate using TaqMan Fast Universal PCR Master Mix (Life Technologies, 4352042) with the following TaqMan gene specific primer-(FAM/MGB) probe mixes (Life Technologies): assay ID PML (Hs00231241_m1), Ubc9 (Hs00163336_m1), Daxx (Hs00985566_g1), ATRX (Hs00997529_m1), Sp100 (Hs00162109_m1), HIRA (Hs00231498_m1), Mx1 (HS00895608_m1), ISG15 (Hs01921425_s1), ISG54 (Hs01922738_s1), OAS1 (Hs00973635_m1), or GAPDH (4333764F) on a 7500 Fast Real time PCR system (Applied Biosystems). Relative mRNA levels were determined using the ΔΔCt method (normalized to GAPDH) and expressed relative to indicated treatments. Mean (RQ) and standard deviations (RQmin/max) are presented.

For IFN-β and IFN-λ quantification, cDNA was prepared from extracted RNA using Maxima First Strand cDNA Synthesis kit for RT-qPCR (Thermofisher, K1672).
qPCR reactions were performed using TakyonTM Low Rox Probe MasterMix dTTP Blue (Eurogentec, B0701) with primers and probe detecting GAPDH (Forward: 5′- GAAGGTGAAGGTCGGAGT -3′, Reverse:5′- GAAGATGGTGATGGGATTTC-3′, Probe: FAM- CAAGCTTCCCGTTCTCAGCC -TAMRA). IFN-β and IFN-λ were analyzed with Applied Biosystems, assay identification numbers Hs01077958_s1 and Hs00601677_g1, following manufacturer’s instructions. For ISG analysis, cDNA was generated from extracted RNA using a high-capacity cDNA reverse transcription kit (Thermofisher, 4368814). qPCR reactions were performed using a Brilliant III Ultra-fast qPCR master mix (Agilent: 600884) to quantify GAPDH, Mx1, ISG15, and IFIT2/ISG54 expression using TaqMan gene-specific primer (FAM/MGB) probe mixes (Life Technologies): assay ID Mx1 (HS00895608_m1), ISG15 (Hs01921425_s1), IFIT2 (Hs01922738_s1), and GAPDH (4333764F).