Taqman gene specific primer fam mgb probe mixes
TaqMan gene specific primer-(FAM/MGB) probe mixes are pre-designed and pre-validated reagents for real-time PCR analysis. These mixes contain a forward primer, a reverse primer, and a FAM/MGB-labeled probe specific to the gene of interest.
Lab products found in correlation
2 protocols using taqman gene specific primer fam mgb probe mixes
Quantification of Antiviral Gene Responses
IFN-β and IFN-λ Quantification Protocol
qPCR reactions were performed using TakyonTM Low Rox Probe MasterMix dTTP Blue (Eurogentec, B0701) with primers and probe detecting GAPDH (Forward: 5′- GAAGGTGAAGGTCGGAGT -3′, Reverse:5′- GAAGATGGTGATGGGATTTC-3′, Probe: FAM- CAAGCTTCCCGTTCTCAGCC -TAMRA). IFN-β and IFN-λ were analyzed with Applied Biosystems, assay identification numbers Hs01077958_s1 and Hs00601677_g1, following manufacturer’s instructions. For ISG analysis, cDNA was generated from extracted RNA using a high-capacity cDNA reverse transcription kit (Thermofisher, 4368814). qPCR reactions were performed using a Brilliant III Ultra-fast qPCR master mix (Agilent: 600884) to quantify GAPDH, Mx1, ISG15, and IFIT2/ISG54 expression using TaqMan gene-specific primer (FAM/MGB) probe mixes (Life Technologies): assay ID Mx1 (HS00895608_m1), ISG15 (Hs01921425_s1), IFIT2 (Hs01922738_s1), and GAPDH (4333764F).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!