U6 bsai sgrna

Manufactured by Addgene

Sourced in United States

The U6::BsaI-sgRNA is a DNA template that can be used to generate single guide RNA (sgRNA) molecules for CRISPR-Cas9 genome editing applications. The template contains the U6 promoter and a BsaI restriction site, which allows for the easy insertion of a target-specific sequence to generate the desired sgRNA.

Automatically generated - may contain errors

Lab products found in correlation

Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (1 mentions) Transit lt1 transfection reagent, by Mirus Bio (1 mentions) Px601, by Addgene (1 mentions) Pspcas9 bb 2a gfp px458, by Addgene (1 mentions) Nls sacas9 nls 3xha bghpa, by Addgene (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Oligonucleotide, by Integrated DNA Technologies (1 mentions)

5 protocols using u6 bsai sgrna

Production and Purification of AAV2/6 Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral production was achieved through transfection of HEK293T cells cultured in 150mm plates with the pAAV6 serotype packaging plasmid (Rutledge et al., 1998 (link)), pXX6 helper plasmid that contains the adenovirus E4, VA and E2a helper regions (Xiao et al., 1998 (link)) and AAV2-ITR containing plasmid expressing dSaCas9 and the control or (CAG)₆ gRNA (generated from the SaCas9 plasmid pX601-AAV-CMV∷NLS-SaCas9-NLS-3xHA-bGHpA;U6∷BsaI-sgRNA, Addgene #61591). Transfections were carried out using the TransIT-LT1 transfection reagent and recommended protocols (MirusBio). Cells were harvested between 48h and 72h post-transfection, recombinant AAV2/6 virus was purified by iodixanol step gradients followed by vector concentration and buffer exchange with lactated Ringer's in an Apollo 150kDa concentrator (Orbital Biosciences) (Zolotukhin et al., 2002 (link)). Virus titers were determined using the Quant-iT Picogreen dsDNA assay kit (Life Technologies) (Piedra et al., 2015 (link)) and found to be ∼10¹¹ vg/mL.

Pinto B.S., Saxena T., Oliveira R., Méndez-Gómez H.R., Cleary J.D., Denes L.T., McConnell O., Arboleda J., Xia G., Swanson M.S, & Wang E.T. (2017). Impeding transcription of expanded microsatellite repeats by deactivated Cas9. Molecular cell, 68(3), 479-490.e5.

+ Open protocol

+ Expand

Expression and Purification of CRISPR Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gene sequences of SaCas9, SpCas9, AsCas12a, and LbCas12a proteins were derived from pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene plasmid # 61591), pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid # 48138), pY010 (pcDNA3.1-hAsCpf1) (Addgene plasmid # 69982), and pY016 (pcDNA3.1-hLbCpf1) (Addgene plasmid # 69988), respectively, which were gifts from Feng Zhang [33] (link)[34] (link)[35] (link). By comparing the fragments of the expression vector and four target genes, we selected SalI and XbaI as the insertion sites between the multiple clone site of the pET28b prokaryotic expression vector. Then primers were designed for the gene sequences of SaCas9, SpCas9, AsCas12a and LbCas12a. The forward primer 5' was added with SalI digestion site sequence, and the reverse primer

Xiao P., Bai R., Zhang T., Wu R., Chen L., Hou Y., Shen B., Niu Y., Li S., Ji W, & Chen Y. (2021). Extensive humoral immune response to AAVs and Cas proteins in nonhuman primates. Science bulletin, 66(20).

+ Open protocol

+ Expand

AAV9-SaCas9 Vector for Brain Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

The AAV9-SaCas9 vector was from pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA (#61593, Addgene, Watertown, MA, USA). The Thyroxine Binding Globulin (TBG) promoter was replaced with human synapsin promoter for better expression in the brain. The single-guide RNAs (sgRNAs) were annealed from DNA oligos with BsaI digest ends. After annealing, the sgRNA segments were inserted into the BsaI site of the vector. The viral titers were as follows: vehicle-control: 4.00 × 10¹² vg/mL; PINK1-A: 7.00 × 10¹² vg/mL; PINK1-B: 9.00 × 10¹² vg/mL; DJ-1-A: 1.20 × 10¹³ vg/mL; DJ-1-B: 8.00 × 10¹² vg/mL.

Li H., Wu S., Ma X., Li X., Cheng T., Chen Z., Wu J., Lv L., Li L., Xu L., Wang W., Hu Y., Jiang H., Yin Y., Qiu Z, & Hu X. (2021). Co-editing PINK1 and DJ-1 Genes Via Adeno-Associated Virus-Delivered CRISPR/Cas9 System in Adult Monkey Brain Elicits Classical Parkinsonian Phenotype. Neuroscience Bulletin, 37(9), 1271-1288.

+ Open protocol

+ Expand

Adenovirus-Based CRISPR Targeting of Mouse XBP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Effective sgRNAs targeting mouse XBP1 were first validated using lentiviral vectors, and adenovirus pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene) targeting (AAV2-sgXbp1) or nontargeting XBP1 (AAV2-sgControl) were generated. Then, 293FT cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with the AAV vector along with helper packaging vectors. Two days later, the cells and media were collected and subjected to four freeze-thaw cycles by alternating between an ethanol dry ice bath and 37 °C. Cell debris was removed by centrifugation and the supernatant was collected, passed through a 0.45 µm filter, aliquoted, and frozen at −80 °C until further use.

Zhao Y., Zhang W., Huo M., Wang P., Liu X., Wang Y., Li Y., Zhou Z., Xu N, & Zhu H. (2021). XBP1 regulates the protumoral function of tumor-associated macrophages in human colorectal cancer. Signal Transduction and Targeted Therapy, 6, 357.

+ Open protocol

+ Expand

CRISPR-Cas9 Exon Skipping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. aureus sgRNAs were designed using the Benchling tool (Table 1). For the dual guide experiment, sgRNAs targeting intron 54 (in54g2) and intron 55 (in55g4) were chosen based on the highest specificity score (in54g2, 83.9; in55g4, 79.5) The sgRNA used for single guide and combo guide experiments was chosen because it targets the Dmd exon 55 splice donor site.Table 1

sgRNAs designed for dual guide, single guide, and combo guide exon skipping experiments

sgRNA	PAM	Oligonucleotide	Sequence (5′→3′)
in54g2	CAGAAT	sa_in54g2s	CACCGAAAGTCAAGAAAATACAAACC
in54g2	CAGAAT	sa_in54g2as	AAACGGTTTGTATTTTCTTGACTTTC
in55g4	CCGGGT	sa_in55g4s	CACCGTCCTAAAAGTCTTAGTGTAG
in55g4	CCGGGT	sa_in55g4as	AAACCTACACTAAGACTTTTAGGAC
in55g1_SD	TTGAGT	sa_in55g1_SDs	CACCGATGAAACCATGGCAAGTAAG
in55g1_SD	TTGAGT	sa_in55g1_SDas	AAACCTTACTTGCCATGGTTTCATC

The sgRNAs were cloned into an SaCas9-expressing plasmid containing inverted terminal repeats (ITRs) for AAV packaging (pX601-AAV-CMV::NLS-SaCas9-NLS-3×HA-bGHpA; U6::BsaI-sgRNA, Addgene plasmid 61591). Oligonucleotides were synthesized by Integrated DNA Technologies. For experimental controls, Addgene plasmid 61591 was modified to exclude SaCas9 and GFP.

Rok M., Wong T.W., Maino E., Ahmed A., Yang G., Hyatt E., Lindsay K., Fatehi S., Marks R., Delgado-Olguín P., Ivakine E.A, & Cohn R.D. (2023). Prevention of early-onset cardiomyopathy in Dmd exon 52–54 deletion mice by CRISPR-Cas9-mediated exon skipping. Molecular Therapy. Methods & Clinical Development, 30, 246-258.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!