Stepone plus quantitative real time pcr detection system

Manufactured by Thermo Fisher Scientific

The StepOne Plus™ quantitative Real Time PCR Detection System is a compact, flexible instrument designed for real-time PCR analysis. It enables precise gene expression analysis and quantification of nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

5x rt pre mix cdna synthesis kit, by Biofact (2 mentions) 2x real time pcr master mix kit, by Biofact (2 mentions) Total rna prep kit, by Biofact (2 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Alleleid software, by Biosoft (1 mentions)

Spelling variants of this product

StepOne Real-Time PCR (74 citations) StepOne PCR system (70 citations) Quantitative real-time PCR (33 citations) StepOne detection system (27 citations) Real-Time System (23 citations) StepOne Plus quantitative PCR system (11 citations) Quantitative real-time PCR system (7 citations) StepOne Plus Real-Time quantitative PCR System (2 citations) StepOne Plus Real Time (2 citations) Real Time PCR StepOne Plus (1 citations)

3 protocols using stepone plus quantitative real time pcr detection system

Cartilage-specific Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the cartilage-specific genes expression, RNA extraction (three samples per group) was done using TRIzol reagents (Invitrogen). In the following, RNA was reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit (Fermentase) with oligo (dT) primers, and then real-time polymerase chain reaction (PCR) was performed using SYBR Green PCR Master Mix (Fermentase) and the Step One Plus™ quantitative real-time PCR detection system (Applied Biosystems). Primers were designed for each gene using the Allele ID software (Primer Biosoft), which generated the following sequences: Collagen II (Forward: CTGGTGATGATGGTGAAG, Reverse: CCTGGATAACCTCTGTGA), collagen X (Forward: AGAATCCATCTGAGAATATGC, Reverse: CCTCTTACTGCTATACCTTTAC), SOX9 (Forward: TTCAGCAGCCAATAAGTG, Reverse: GTGGAATGTCTTGAAGGTTA), aggrecan (Forward: GTGGGACTGAAGTTCTTG, Reverse: GTTGTCATGGTCTGAAGTT). In addition, GAPDH primer was used as an internal control within these sequences: Forward: AAGCTCATTTCCTGGTATG, Reverse: CTTCTTCTTGTGCTCTTG.
Finally, all data were analyzed using one-way analysis of variance (ANOVA). In addition, Data are presented as mean ± standard error of the mean and P ≤ 0.05 was considered to be statistically significant.

Basiri A., Hashemibeni B., Kazemi M., Valiani A., Aliakbari M, & Ghasemi N. (2020). Cartilage tissue formation from human adipose-derived stem cells via herbal component (Avocado/soybean unsaponifiables) in scaffold-free culture system. Dental Research Journal, 17(1), 54-59.

+ Open protocol

+ Expand

Profiling Neuronal and Glial Markers in Rat Sciatic Nerve

Check if the same lab product or an alternative is used in the 5 most similar protocols

The level of S100, MBP, GFAP and Nestin expression in the rat sciatic nerve tissue were assessed using real time RT-PCR. Total RNA was isolated using the Total RNA Prep Kit (BIOFACT). RNA was reverse transcribed using the BioFact™ 5X RT Pre-Mix cDNA Synthesis Kit (BIOFACT) according to the manufacturer’s protocol. The expression of target genes was evaluated using BioFact™ 2X Real-Time PCR Master Mix Kit (BIOFACT) through StepOne Plus™ quantitative Real Time PCR Detection System (Applied Biosystems). The level of β-actin was used as the control housekeeping gene. Table 2 lists the sequence of the used primers (metabion, Germany) [23 (link)].Table 2

The list of primer sequences of S100; Schwann cell marker, Nestin; Marker of neuronal progenitor cells, Gfap; Glial fibrillary acidic protein, Mbp; Myelin basic protein, β-actin; As the control housekeeping gene for Real time RT-PCR analysis

Gene	Primer (forward (top) reverse (bottom))
S100	5′-ATAGCACCTCCGTTGGACAG-3′
S100	5′-TCGTTTGCACAGAGGACAAG-3′
Nestin	5′-CCGGGTCAAGACGCTAGAAGA-3′
Nestin	5′-CTCCAGCTCTTCCGCAAGGTTGT-3′
Gfap	5′-CTCCTATGCCTCCTCCGAGACGAT-3′
Gfap	5′-GCTCGCTGGCCCGAGTCTCTT-3′
Mbp	5′-CACAGAAGAGACCCTCACAGCGAC-3′
Mbp	5′-CCGCTAAAGAAGCGCCCGATGGA-3′
β-actin	5′-GTTGTCGACGACGAGCG-3′
β-actin	5′-GCACAGAGCCTCGCCTT-3′

Razavi S., Jahromi M., Vatankhah E, & Seyedebrahimi R. (2021). Differential effects of rat ADSCs encapsulation in fibrin matrix and combination delivery of BDNF and Gold nanoparticles on peripheral nerve regeneration. BMC Neuroscience, 22, 50.

+ Open protocol

+ Expand

Quantitative Analysis of Sciatic Nerve Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The level of S100, MBP, GFAP and Nestin expression in the rat sciatic nerve tissue in were assessed using real time RT-PCR. Total RNA was isolated using the Total RNA Prep Kit (BIOFACT). RNA was reverse transcribed using the BioFact™ 5X RT Pre-Mix cDNA Synthesis Kit (BIOFACT) according to the manufacturer's protocol.
The real-time PCR was performed using BioFact™ 2X Real-Time PCR Master Mix Kit (BIOFACT) and the StepOne Plus™ quantitative Real Time PCR Detection System (Applied Biosystems). The level of β-actin was used as the control housekeeping gene. Table 1 lists the sequence of the used primers (metabion, Germany) [23] (link).

Razavi S., Jahromi M., Vatankhah E., & Seyedebrahimi R. (2020). Differential Effects of Encapsulation of Rat ADSCs in Fibrin Matrix and Combination Delivery of BDNF and Gold Nanoparticles on Peripheral Nerve Regeneration.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!