RNA expression levels of genes of interest (ALDH1A1 and MAOA) were quantified using qPCR, essentially performed as described previously [35] (link). Briefly, RNA was isolated using the RNAeasy system (Qiagen), 2 μg each of total RNA was reverse transcribed using the iScript cDNA synthesis system (Bio-Rad) and 10 ng of each sample was analyzed in technical triplicates. Relative mRNA expression of ALDH1A1 and MAOA was normalized to β-actin mRNA as a control housekeeping gene. Relative mRNA abundance was calculated by the ddCt method. The following primer pairs were used, ALDH1A1 forward: 5′-ATCAAAGAAGCTGCCGGGAA-3′, ALDH1A1 reverse: 5′-TCTTAGCCCGCTCAACACTC-3′, MAOA forward: 5′-GCATTTCAGGACTATCTGCTGC-3′, MAOA reverse: 5′-GGTCCCACATAAGCTCCACC-3′, Actin forward AGCACTGTGTTGGCGTACAG, and Actin reverse CTCTTCCAGCCTTCCTTCCT. The cycling conditions were as follows: one cycle of 72°C for 1 min; 40 cycles of 95°C for 15 s, 56°C for 30 s, 72°C for 30 s; and one cycle of 72°C for 5 min.
Rnaeasy system
Manufactured by Qiagen
Sourced in Germany
The RNAeasy system is a laboratory equipment designed for the isolation and purification of high-quality RNA from a variety of biological samples. It utilizes a silica-based membrane technology to efficiently capture and purify RNA, providing a reliable and reproducible method for RNA extraction.
Automatically generated - may contain errors
4 protocols using rnaeasy system
1
Quantifying ALDH1A1 and MAOA Gene Expression
2
Quantitative Real-Time PCR Analysis of Murine Transcripts
3
Microarray Analysis of C. glutamicum Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from exponentially growing cells by using the RNAeasy system (QIAGEN, Hilden, Germany) with on-column DNase I treatment prepared as described [61 (link)]. Quantity and quality of purified RNA was analyzed by UV-spectrometry and stored at −20 °C until use. DNA microarrays are based on PCR products of C. glutamicum genes [62 (link)]. Synthesis of fluorescently labelled cDNA from total RNA, microarray hybridization, washing and gene expression analysis were carried out as described previously [61 (link)–63 (link)]. The data are available as Gene Expression Omnibus GSE67012 data set at http://www.ncbi.nlm.nih.gov/geo/ .
4
Circular RNA Enrichment Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNase R is a 3′ to 5’exoribonuclease that degrades linear RNAs without affecting circular RNAs [19 (link)]. RNase R treatment was performed as previously described to enrich circular RNAs [20 ]. In brief, RNAs were isolated from Ishikawa and HEC-1-B cells using RNAeasy system and on-column DNAse digestion (Qiagen, Hilden, Germany). In the first replicate, 60 μg total RNAs were depleted for ribosomal RNAs using RiboMinus kit (Invitrogen) in 6 separate 10-μg reactions. In the second biological replicate, 20 μg total RNAs were depleted for ribosomal RNAs. A total of six 14.3-μL RNase R reactions or mock treatment aliquots were prepared for each replicate. Samples were denatured at 70 °C and then chilled to 40 °C using a thermocycler. Next, 1.7 μL 10× RNase R buffer was added to each sample. A volume of 1 μL water was added in one of the six reactions, and 1 μL RNase R was added to the remaining reactions. The reactions proceeded for 1 h at 40 °C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!