Midiprep kit

Manufactured by Thermo Fisher Scientific

The Midiprep kit is a laboratory equipment designed for the purification of plasmid DNA. It provides a reliable and efficient method to extract and purify plasmid DNA from bacterial cultures.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PureLink HiPure Plasmid Midiprep Kit (64 citations) PureLink HiPure Plasmid Filter Midiprep Kit (22 citations) GeneJET Plasmid Midiprep Kit (16 citations) HiPure Plasmid Midiprep kit (8 citations) Plasmid Midiprep Kit (3 citations) HiPure Midiprep kit (2 citations) Hipure Plasmid Filter Midiprep Kit (2 citations) DNA Midiprep kit (2 citations)

9 protocols using midiprep kit

EGFP Insertion in celsr3 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used standard BAC recombineering strategies to place EGFP downstream
of the celsr3 promoter (Dhaka et
al. 2007) (Chatterjee and Lufkin
2011). We used BAC CH73-42M24 obtained from Children’s
Hospital Oakland Research Institute (http://bacpac.chori.org/zebrafish71.htm), which is labeled as
zH42M24T7 on the Sanger Welcome Trust web site. Briefly, PCR was performed to
create a fragment containing EGFP and the kanamycin resistance gene flanked by
LoxP sites. Engineered on either side of this construct were domains containing
homology to celsr3 exon1 in the BAC. This was done using
primers forward (GGATTTCACTAGACTAATGGTGAGCAAGGGCGAGGAG) and reverse
(CTTGCTCACCATTAGTCTAGTGAAATCCTTTCTCTCTC). Bacteria containing the BAC were
electroporated with the fragment and then recombination was induced and selected
for by kanamycin resistance. Colonies that were kanamycin resistant were grown
and prepped using an Invitrogen Midi prep kit according to manufacturer
instructions, except that DNA was pipetted a minimum number of times to avoid
shearing. Colonies were checked by PCR and sequencing. After EGFP insertion was
confirmed, the DNA was treated with Cre recombinase to remove the kanamycin
resistance gene. The final DNA product was then re-electroporated into
Bacteria.

Lewis A.A., Mahoney J.T., Wilson N, & Brockerhoff S.E. (2014). Identification of amacrine subtypes that express the atypical cadherin celsr3. Experimental eye research, 130, 51-57.

+ Open protocol

+ Expand

Generating thsd7a-GFP Transgenic Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

thsd7a-GFP transgenic zebrafish was created by using bacterial artificial chromosome (BAC) homologous recombination. The thsd7a-containing BAC clone was purchased commercially (Plasmid HUKGB735L10208Q, Source BioScience). First, thsd7a BAC plasmid was extracted from overnight culture cell broth by Midiprep kit (Invitrogen, Carlsbad, CA). The extracted BAC was transformed into EL250 competent cells by electroporation and the flip recombinase activity was induced by 42 °C incubation, BAC-contained EL250 competent cells were selected with chloramphenicol antibiotic. Secondly, specific forward primer was designed by adding 45 base pairs of gene specific sequence together with the green fluorescent protein (GFP) forward primer, and 45 bp of gene specific sequence together with the anti-kanamycin reverse primer. We used a PCR long tailing method to make the GFP-Km DNA cassette for insertion of GFP into the thsd7a BAC clone. After homologous recombination, the first exon of thsd7a was partially replaced with GFP, resulting in the thsd7a-GFP construct driven by the thsd7a regulatory elements in the BAC clone. The construct was then microinjected into zebrafish embryos at one to two cell stages to generate stable lines.

Liu L.Y., Lin M.H., Lai Z.Y., Jiang J.P., Huang Y.C., Jao L.E, & Chuang Y.J. (2016). Motor neuron-derived Thsd7a is essential for zebrafish vascular development via the Notch-dll4 signaling pathway. Journal of Biomedical Science, 23, 59.

+ Open protocol

+ Expand

SARS-CoV-2 and Nipah Virus Protein Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

•

SARS-CoV-2 spike is in a pCAGG backbone and expresses the codon-optimized Wuhan-Hu-1 isolate (NCBI accession no. NC_045512.2).

•

SARS-CoV-2 sRBD (NCBI GenBank accession no. MT380724.1 from the Krammer lab) is in a pCAGG backbone and expresses the codon-optimized sequence from the Wuhan-Hu-1 isolate. The sRBD-His, used for neutralization studies, was generated from this construct.

•

VSV-G is in a pCAGG backbone and expresses wild-type Indiana strain VSV-G (Genbank accession no. ACK77583.1).

•

ACE2 packaging construct (GeneCopoeia; catalog [cat.] no. EX-U1285-Lv105) uses a cytomegalovirus (CMV) promoter to express ACE2 and bears a puromycin selection marker in the integrating cassette.

•

The TMPRSS2 packaging construct (GeneCopoeia; cat. no. EX-Z7591-Lv197) uses a CMV promoter to express TMPRSS2 and bears a blasticidin selection marker in the integrating cassette.

•

The psPAX2 2nd-generation lentiviral packaging plasmid (Addgene 12259) expresses HIV-1 Gag, Pol, and Pro proteins.

•

The NiV-RBP is in a pCAGG backbone and expresses the hemagglutinin (HA)-tagged, codon-optimized NiV receptor binding protein.

All plasmids listed here are ampicillin resistant. These constructs were transformed into stellar competent cells, grown in bacterial growth media containing carbenicillin, prepared using Invitrogen’s midiprep kit, and sequence verified prior to use for experiments.

Oguntuyo K.Y., Stevens C.S., Hung C.T., Ikegame S., Acklin J.A., Kowdle S.S., Carmichael J.C., Chiu H.P., Azarm K.D., Haas G.D., Amanat F., Klingler J., Baine I., Arinsburg S., Bandres J.C., Siddiquey M.N., Schilke R.M., Woolard M.D., Zhang H., Duty A.J., Kraus T.A., Moran T.M., Tortorella D., Lim J.K., Gamarnik A.V., Hioe C.E., Zolla-Pazner S., Ivanov S.S., Kamil J.P., Krammer F, & Lee B. (2021). Quantifying Absolute Neutralization Titers against SARS-CoV-2 by a Standardized Virus Neutralization Assay Allows for Cross-Cohort Comparisons of COVID-19 Sera. mBio, 12(1), e02492-20.

+ Open protocol

+ Expand

Ampicillin-Resistant Plasmid Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oguntuyo K.Y., Stevens C.S., Hung C.T., Ikegame S., Acklin J.A., Kowdle S.S., Carmichael J.C., Chiu H.P., Azarm K.D., Haas G.D., Amanat F., Klingler J., Baine I., Arinsburg S., Bandres J.C., Siddiquey M.N., Schilke R.M., Woolard M.D., Zhang H., Duty A.J., Kraus T.A., Moran T.M., Tortorella D., Lim J.K., Gamarnik A.V., Hioe C.E., Zolla-Pazner S., Ivanov S.S., Kamil J.P., Krammer F, & Lee B. (2020). Quantifying absolute neutralization titers against SARS-CoV-2 by a standardized virus neutralization assay allows for cross-cohort comparisons of COVID-19 sera. medRxiv.

+ Open protocol

+ Expand

Targeted Gene Disruption in Transgenic Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

All plasmids used for embryo injections were extracted from transformed Escherichiacoli cells using a plasmid Midiprep kit from Thermo Fisher Scientific. To disrupt the Nopp140 gene, the plasmid injection mixture contained 15 ng µl⁻¹ of gRNA#52, 15 ng µl⁻¹ of gRNA#99, and 230 ng µl⁻¹ of pDsRed-Donor. The mixture was injected into homozygous nanos-Cas9 transgenic embryos. To disrupt the DsRed gene, the CRISPR injection mixture contained 75 ng µl⁻¹ of gRNA#2, 75 ng µl⁻¹ of gRNA#3, and 350 ng µl⁻¹ of pBS-Hsp70-Cas9. This mixture was injected into J11 DsRed/TM3-GFP embryos. All injections were performed by GenetiVision Corporation (Houston, TX, USA).

Baral S.S., Lieux M.E, & DiMario P.J. (2020). Nucleolar stress in Drosophila neuroblasts, a model for human ribosomopathies. Biology Open, 9(4), bio046565.

+ Open protocol

+ Expand

Gene editing of hiPSCs using electroporation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene editing at the TH locus, a Neon electroporation system was used (ThermoFisher, cat# MPK5000), using methodology adapted for gene editing hiPSC (Buchrieser et al., 2017 (link); Flynn et al., 2015 (link)). 3 × 10⁶ hiPSCs of each cell line were transfected by electroporation (1250 V, 20 ms pulse width, 1pulse) in a 100µL tip with 15 µg total DNA (3.11 µg sgRNA plasmid and 11.35 Donor plasmid). All plasmids used for electroporation were prepared using an endotoxin free MidiPrep Kit (ThermoFisher, cat# K210004). After electroporation, the cells were plated at high density (4 × 10⁵ cells/cm²) in StemMACS medium without Pen/Strep containing 10 µM Rock-Inhibitor (Miltenyi, cat# 130–104–169). 24 h after electroporation Puromycin (SantaCruz Biotechnology, cat# sc-108071A) selection was started with 0.5 µg/ml for 48 h. After another 24 h without Puromycin cells were replated onto MEF cells for clonal selection (see supplementary information) and some were lysed for gDNA extraction for HDR screen.

Überbacher C., Obergasteiger J., Volta M., Venezia S., Müller S., Pesce I., Pizzi S., Lamonaca G., Picard A., Cattelan G., Malpeli G., Zoli M., Beccano-Kelly D., Flynn R., Wade-Martins R., Pramstaller P.P., Hicks A.A., Cowley S.A, & Corti C. (2019). Application of CRISPR/Cas9 editing and digital droplet PCR in human iPSCs to generate novel knock-in reporter lines to visualize dopaminergic neurons. Stem Cell Research, 41, 101656.

+ Open protocol

+ Expand

Mitochondrial Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

pDsRed2-Mito vector (Clontech) was amplified using GT115 competent E. coli cells (InvivoGen) and isolated with a Midiprep kit (Thermo Fisher Scientific). For each transfection, 8 μg of plasmid DNA was diluted in 100 μL serum-free Opti-MEM I (Thermo Fisher Scientific). 10 μL Lipofectamine-2000 (Thermo Fisher Scientific) was diluted in 100 μL serum-free Opti MEM I and allowed to stand for 10 min at room temperature. The plasmid and lipofectamine solutions were combined, gently mixed, and allowed to stand for 20 min at room temperature before application to cultures. Cells were transfected at 12.5 DIV. Cultures were imaged 36 h post-transfection.

Cavendish J.Z., Sarkar S.N., Colantonio M.A., Quintana D.D., Ahmed N., White B.A., Engler-Chiurazzi E.B, & Simpkins J.W. (2019). Mitochondrial Movement and Number Deficits in Embryonic Cortical Neurons from 3xTg-AD Mice. Journal of Alzheimer's disease : JAD, 70(1), 139-151.

+ Open protocol

+ Expand

Molecular Cloning Protocol: Transformation and Plasmid Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bactotryptophan (code 91079-40-2); Bacto yeast (code 8013-01-2); Sodium Chloride (code 7647-14-5); Agar (code 9002-18-0); Calcium Chloride (code 10035-04-8); Isopropanol (code 67-63-0); Ethanol (code 64-17-5); SSC Buffer (code 6135-04-3); Hind III (code 81295-22-9); BGL II (code 81295-12-7); Ammonium Citrate Tribasic (code 3458-72-8); Citric Acid (code 77-92-9); Lysine (code 56-87-1); Ferrous Sulphate (code 7720-78-7) were all from Sigma Aldrich. Glycerol (code 56-81-5); Midiprep Kit, (code K0841); Agarose Gel (code 9012-36-6); Propidium Iodide (code 25535-16-4); DNA Digestion Kit (code AM1907); Ligation Buffer (code IVGN2104) were from Thermo Fischer Scientific. Ampicillin (code 69-52-3) and Tris Acetate Buffer (code 135852-26-5) were from Fischer Scientific; Blue-Orange Loading Dye was from Promega; Miniprep Kit was from Euro genomics and Ferric Chloride (code 7705-08-0) was from Merck Millipore.

Kundu K., Teta R., Esposito G., Stornaiuolo M, & Costantino V. (2023). A Four-Step Platform to Optimize Growth Conditions for High-Yield Production of Siderophores in Cyanobacteria. Metabolites, 13(2), 154.

+ Open protocol

+ Expand

pKJK5::csg[aacC1] plasmid sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

pKJK5::csg[aacC1] plasmid DNA was extracted using a Thermo Fisher Midiprep kit. Plasmid DNA was Illumina-sequenced by the University of Liverpool Centre for Genomic Research. Bioinformatics analyses and sequence assembly were carried out using Bash and Conda.
We analysed read quality using FastQC v0.11.9 and discarded poor-quality reads using Trimmomatic v0.39. Assembly was carried out using SPAdes v3.15.2 with the settings --plasmid and --careful. QUAST v5.0.2 was used to try multiple settings and select the best assembly. Finally, SPAdes-generated contigs were visualized using Bandage v0.8.1 and aligned to GenBank-deposited pKJK5 (AM261282.1) and E. coli K12 sequences (NZ_CP010444.1). Contigs that aligned to E. coli K12 were discarded, which yielded a single circular contig encoding pKJK5 and the CRISPR-Cas9 cassette. This contig contained a 127 bp duplication as an artefact of circularization, which we removed as a post-processing step. pKJK5::csg[aacC1] is identical to its theoretical sequence, except for a single-nucleotide deletion in the pKJK5 backbone 12 nt upstream of trfA. pKJK5::csg[aacC1] is deposited on GenBank under the accession number OP921802.

Walker-Sünderhauf D., Klümper U., Pursey E., Westra E.R., Gaze W.H, & van Houte S. (2023). Removal of AMR plasmids using a mobile, broad host-range CRISPR-Cas9 delivery tool. Microbiology, 169(5), 001334.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!