Puregene cell and tissue kit

We first performed a conventional Sanger sequencing analysis for all suppressor alleles for cebp-1 and determined that the ju1367 allele affected cebp-1. We next sequenced mak-2, which was previously known to act in the same pathway as cebp-1 in neurons [22 (link)], and found ju1349 and ju1352 alleles to affect mak-2. All other suppressors were analysed by whole genome sequencing analysis and single-nucleotide polymorphism (SNP) mapping following established methods [51 (link)]. Briefly, genomic DNA was prepared using a Puregene Cell and Tissue Kit (Qiagen) according to the manufacturer’s instructions, and 20X coverage of sequences was obtained using a 90 bp paired-end Illumina HiSeq 2000 at Beijing Genomics Institute (BGI Americas). The raw sequences were mapped to the C. elegans reference genome (WS220/ce10) using Burrows-Wheeler Aligner (BWA) [52 (link)] in the Galaxy platform (http://usegalaxy.org) [53 (link)]. Following subtraction of the nucleotide variants in the original strains, we generated a list of candidate genes containing unique homozygous nucleotide variants that were predicated to alter the function of the gene. We then confirmed the causality of the candidate genes by testing the known null alleles on the suppression of nipi-3(0).

Long-range PCR was performed on genomic DNA extracted from liver samples using the Puregene Cell and Tissue Kit (Qiagen) with PrimeSTAR GXL DNA polymerase (Takara Bio). To ensure the representativeness of results for each mouse, 2–3 replicates of 20 µl PCR reactions were used, with each reaction containing 400 ng of genomic DNA and 0.5 µM primers. The first long-range PCR was conducted with cycling conditions of 98 °C for 1 min, followed by 25 cycles of 98 °C for 10 s, 64 °C for 15 s, and 68 °C for 6.5 min. Barcode-containing primers were used to amplify DNA from size-selected first PCR products for nanopore sequencing. In addition, indel-correcting 11-nt DNA barcodes were also used to prevent sample misalignment during demultiplexing of pooled nanopore sequencing reads [50 ]. The second PCR thermal cycler program was as follows: 98 °C for 1 min, followed by 20 cycles of 98 °C for 10 s, 64 °C for 15 s, and 68 °C for 6.5 min. All PCR products were visualized by electrophoresis on 1% agarose gel.

First, we harvested livers of mice at three weeks and three months after in vivo editing and extracted genomic DNA using the Puregene Cell and Tissue Kit (Qiagen). Then, we performed the first long-range PCR with the conditions described above and purified the products, followed by the cleavage with RNP-sgAlb and RNP-sgBB. After that, the secondary size selection and PCR were carried out to amplify the F8 inserts further. The subsequent amplicons were subjected to nanopore sequencing for comprehensive analysis. As detailed above, we analyzed the F8 and BB insertion patterns and summarized the single BB inserts, single F8 inserts, tandem F8 and BB inserts, and other patterns.

The total gastrocnemius DNA was isolated using Puregene Cell and Tissue Kit (Qiagen) and was amplified using specific primers for mtCOXII and 18S by real-time PCR using the Power SYBR Green RT-PCR kit (Applied Biosystems). The mtDNA copy number was calculated using 18S amplification as a reference for nuclear DNA content. Real-time PCR was performed with the following primers:
18S Fw: CATTCGAACGTCTGCCCTATCA
18S Rw: GGGTCGGGAGTGGGTAATTTG
COXII Fw: GCCGACTAAATCAAGCAACA
COXII Rw: CAATGGGCATAAAGCTATGG