Pmirglo dual luciferase mirna target expression vector

We used bioinformatics databases (Starbase v2.0, miRcode and RNAhybrid) to search for the miR-29a binding site in QKI-6. The 3′-UTR fragment of the wild-type QKI-6 gene (QKI-6-3′-UTR-Wt) or the mutant gene with respect to the predicted miR-29a binding sites (QKI-6-3′-UTR-Mut) were subcloned into pmirGLO Dual-luciferase miRNA Target Expression Vectors (GenePharma). HEK 293T cells were seeded in a 24-well plate and co-transfected with QKI-6-3′-UTR-Wt (or QKI-6-3′-UTR-Mut) and agomir-29a by means of Lipofectamine 3000. After the cells were incubated for 48 hours at 37 °C, the luciferase reporter assay was performed with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA).

The pmirGLO Dual-Luciferase miRNATarget expression vector was purchased from GenePharma (Shanghai, China), and the luciferase reporter plasmid was inserted into the wild-type WT-MFI2-AS1 and Mut-MFI2-AS1 3'UTR sequences. Firefly luciferase was used as the primary reporter gene to regulate mRNA expression, and Renilla luciferase was used as a normalization control. Dual-luciferase reporter gene assay system (Promega) was used 48 h after transfection. The mean luciferase intensity was normalized to Renilla luciferase. Data are shown as mean ± SD and each experiment was performed three times.

Wild-type (WT) mRNA-SOCS3 (SOCS3 WT: 5′-3′:TGTTTTGAATAATGTTTACAATTTGCCTCAATCACT), which can bind to miR-30a-5p, was amplified by PCR and inserted into the pmirGLO dual-luciferase miRNA target expression vector (GenePharma). The mutant-type (MUT) mRNA-SOCS3 (SOCS3 MUT: 5′-3′:TGTTTTGAATAAACAAATGTATTTGCCTCAATCACT) was inserted into the reporter vector and transfected as the NC. These vectors were cotransfected with miR-30a-5p mimic or mimic-NC into cells using Lipofectamine 3000 reagent. At 24 h posttransfection, the dual-luciferase reporter assay system (Promega, Madison, WI, USA) was used to determine luciferase activity.

All cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. The miR-29a-5p mimic/inhibitor and their respective controls were purchased from GenePharma Co., Ltd. Twenty hours after transfection, the RAW 264.7 cells were treated with 10% FBS. The cells were then harvested and lysed for qRT-PCR and Western blotting analysis. Restriction enzyme digestion and one-step cloning (ClonExpress II One-Step Cloning Kit, C112-02; Vazyme Biotech Co., Ltd.) were used to construct the luciferase reporter plasmids. The fragment of the mouse NLRP3 3′-UTR containing the miR-29a-5p binding site and its mutant sequences (Supplemental Table S1) were synthesized, respectively, and then were inserted into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (GenePharma, Suzhou) digested by Xho1 and Sal1.

A targeted association between miR‐29b‐3p and 3′‐UTR of H19 or DKK1 was detected using dual‐luciferase reporter gene detection. The 3′‐UTR fragment of the WT H19 sequence or DKK1 mRNA was amplified and inserted into the pmiRGLO dual‐luciferase miRNA target expression vector (GenePharma, Shanghai, China), and pmiRGLO‐H19‐WT or pmiRGLO‐Dkk1‐WT was constructed. The GeneArt™ Site‐Directed Mutagenesis PLUS System (Thermo Fisher, USA) was adopted to mutate the putative binding site of the miR‐29b‐3p family in H19 or Dkk1 3′‐UTR. MUT H19 or Dkk1 3′‐UTR was inserted into the pmiRGLO carrier to form pmiRGLO‐H19‐MUT or pmiRGLO‐Dkk1‐MUT. HEK293T cells were purchased from the Shanghai Institute of Cell Biology of the Chinese Academy of Sciences (Shanghai, China). HEK293T cells were seeded in 96‐well plates at 60% confluence. miRNAs and dual‐luciferase vectors were co‐transfected with Liposome 3000 reagent (Invitrogen, USA). After 48 h, the cells were lysed, and luciferase activity was measured using the same method as the dual‐luciferase reporter detection system (GenePharma, Shanghai, China) according to the manufacturer's specifications.
²⁵ (link)

ATB fragment containing the predicted miR-200a binding site, the putative sequences of the binding site then cloned into a pmirGlO Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to form the reporter vector pmiRGLO-ATB-wild-type (ATB-WT). To mutate the putative binding site of miR-200a in ATB gene, the sequence of putative binding site was replaced as indicated and was named as pmiRGLO-ATB-mutated-type (ATB-MUT). pmirGLO-ATB-WT or pmirGLO-ATB-MUT was cotransfected with miR-200a mimics or miR-200a NC into glioma cells by using Lipofectamie 2000 (Invitrogen, USA). After 48 h transfection for luciferase assay using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s protocol.
Similarly the 3’-UTR of TGF-β2 containing the putative miR-200a binding site, the putative sequences of the binding site were cloned into a pmirGlO Dual-luciferase miRNA Target Expression Vector to form the reporter vector TGF-β2-wild-type (TGF-β2-WT) (GenePharma). To mutate the putative binding site of miR-200a in the 3′-UTR-containing vector, the sequence of putative binding site was replaced as indicated and was named as TGF-β2-mutated-type (TGF-β2-MUT). The transfection procedure and measurement of Luciferase activities were handled similarly as described above. All assays were independently performed in triplicate.