Titan krios g3

Manufactured by Thermo Fisher Scientific

Sourced in France, United States

The Titan Krios G3 is a transmission electron microscope (TEM) designed for high-resolution structural biology applications. It features advanced optics, stable cryogenic sample handling, and an intuitive user interface for optimal performance and ease of use.

Automatically generated - may contain errors

Lab products found in correlation

40 protocols using titan krios g3

Cryo-EM analysis of Sei1 complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four microliters of purified Sei1 or Sei1-Ldb16 complex at a concentration of 4 mg/mL was adsorbed to glow-discharged gold UltrAufoil grids (300 mesh, R1.2/1.3) for 10 s. Grids were then blotted for 2 s at 100% humidity at 9 °C and frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific). Data were collected in counting mode on a Titan Krios G3 (FEI) operating at 300 kV with a GIF energy filter (Gatan) and K2 Summit detector (Gatan) using a pixel size of 0.822 Å, a dose rate of 6 e⁻ per Å² per s and an exposure of 8 s, corresponding to a total dose of 48 e⁻ per Å² collected over 32 fractions.
Four microliters of purified Sei1∆231-243 (Sei1^∆LH) at a concentration of 7.8 mg/ml was adsorbed to a glow-discharged gold UltrAufoil grid (300 mesh, R1.2/1.3) for 10 s. Grids were then blotted for 2 s at 100% humidity at 6 °C and frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific). Data were collected in counted super-resolution mode on a Titan Krios G3 (FEI) operating at 300 kV with a BioQuantum imaging filter (Gatan) and K3 direct detection camera (Gatan) at 105,000× magnification, physical pixel size of 0.832 Å. Data were collected at a dose rate of 22.2 e− per Å² per s and an exposure time of 2.66 s, corresponding to a total dose of 59.1 e− per Å2 collected over 40 fractions.

Klug Y.A., Deme J.C., Corey R.A., Renne M.F., Stansfeld P.J., Lea S.M, & Carvalho P. (2021). Mechanism of lipid droplet formation by the yeast Sei1/Ldb16 Seipin complex. Nature Communications, 12, 5892.

+ Open protocol

+ Expand

Cryo-EM Structural Analysis of CDV H-Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified CDV H-protein ectodomain was diluted to 1.2 mg/mL in TBS containing 0.1% (w/v) β-D-octyl glucoside. Diluted protein sample was applied to Quantifoil R2/1 200 mesh copper holey-carbon grids that were glow discharged for 10 s at 10 mA and 0.25 mbar. Samples were blotted for 3.5 s and vitrified in liquid ethane using a Vitrobot Mark IV (Thermo Fisher) at 4 °C and 100% humidity. Data were acquired on a Titan Krios G3 (Thermo Fisher) operated at 300 kV and equipped with a Quantum-K3 direct electron detector (Gatan). Micrograph movies were recorded in counting mode at a magnification of 105,000× (corresponding to a calibrated pixel size of 0.822 Å) and a defocus range of −1.0 to −2.0 μm. A total of 26,339 movies from two different grids (two datasets) were collected. Movies were recorded for 1.5 s with a dose rate of 1.26 e⁻/Å²/frame, resulting in a total accumulated dose on the specimen level of approximately 50 e⁻/Å² per exposure.

Kalbermatter D., Jeckelmann J.M., Wyss M., Shrestha N., Pliatsika D., Riedl R., Lemmin T., Plattet P, & Fotiadis D. (2023). Structure and supramolecular organization of the canine distemper virus attachment glycoprotein. Proceedings of the National Academy of Sciences of the United States of America, 120(6), e2208866120.

+ Open protocol

+ Expand

Cryo-EM Data Collection on Titan Krios

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 3.5 µL of sample were applied to glow discharged 1.2/1.3 Quantifoil holey carbon grids (Quantifoil Micro Tools GmbH, Großlöbichau, Germany) and they were plunged frozen in liquid ethane with a Vitrobot Mark IV (Thermo Fisher Scientific) (100% humidity, 20 °C, 6 s blot time, blot force 0). The sample was observed at the beamline CM01 of the ESRF (European Synchrotron Radiation Facility, Grenoble, France) [36 (link)] with a Titan Krios G3 (Thermo Fischer Scientific) at 300 kV equipped with an energy filter (Bioquantum LS/967, Gatan, Inc., Pleasanton, CA, USA) (slit width of 20 eV) and a Volta phase plate. Moreover, 2376 images were recorded automatically on a K2 summit direct electron detector (Gatan, Inc., USA) in super resolution mode with EPU software (Thermo Fisher Scientific). Movies were recorded for a total exposure of 3 s and 100 ms per frame resulting in 30 frame’s movies with a total dose of ~35 e−/Å2. The magnification was 215,000× (0.325 Å/pixel at the camera level). The defocus of the images varies between −0.5 and −1.0 μm. The phase plate position was changed automatically every ~110 images, which corresponds to an accumulated dose of ~50 nC on each phase plate position.

Hograindleur M.A., Effantin G., Fenel D., Mas C., Lieber A., Schoehn G., Fender P, & Vassal-Stermann E. (2020). Binding Mechanism Elucidation of the Acute Respiratory Disease Causing Agent Adenovirus of Serotype 7 to Desmoglein-2. Viruses, 12(10), 1075.

+ Open protocol

+ Expand

Cryo-EM Analysis of ADP-Bound RAD51 Filament Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ADP-bound filament assembly reaction was incubated with 6 μM hRAD51 protein and 36 μM 80-nt Oligo 1 (5′TTATGTTCATTTTTTATATCCTTTACTTTATTTTCTCTGTTTATTCATTTACTTATTTTGTATTATCCTTATCTTATTTA-3′) in a buffer (35 mM Tris-HCl at pH 7.5, 108 mM KCl and 1 mM DTT) containing 1 mM ADP, 5 mM CaCl₂, and 2.5 mM MgCl₂ at 37 °C for 30 min. Protein samples were applied on a pre-glow-discharged graphene-oxide-coated Quantifoil holey carbon grid. The grids were blotted and plunge-frozen in liquid ethane using a Vitrobot Mark IV system (Thermo Fisher). Cryo-EM data were acquired on a Titan Krios G3 (Thermo Fisher) microscope operated at 300 KeV, equipped with a Quantum K3 Summit direct electron detector (Gatan), with an energy-selecting slit of 18 eV. Automatic data acquisition was carried out at a nominal magnification of 105,000, yielding a pixel size of 0.83 Å. Movies of 50 frames, corresponding to a total dose of 50 e⁻Å⁻², were collected in super-resolution mode at a dose rate of 1 e⁻Å⁻² per frame and internal defocus range of −1 to −2 μm.

Luo S.C., Yeh M.C., Lien Y.H., Yeh H.Y., Siao H.L., Tu I.P., Chi P, & Ho M.C. (2023). A RAD51–ADP double filament structure unveils the mechanism of filament dynamics in homologous recombination. Nature Communications, 14, 4993.

+ Open protocol

+ Expand

Cryo-EM Analysis of SprA Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Before grid preparation, SprA complexes purified from various genetic backgrounds were concentrated to an absorbance at 280 nm (A₂₈₀) ranging from 0.5 to 3.1 and in vitro-reconstituted SprA–model substrate complexes were concentrated to an A₂₈₀ of 1.0 (mCherry–CTD_RemA complex) and 2.3 (mCherry–CTD_FspA complex). Four microlitres of each sample was applied onto glow-discharged (30 s, 15 mA) 300 mesh Quantifoil Au R1.2/1.3 holey carbon coated grids, adsorbed for 10 s, blotted for 2 s at 100% humidity at 4–8 °C and plunge frozen in liquid ethane using a Vitrobot Mark IV (ThermoFisher).
Electron microscopy was performed on a Titan Krios G3 (ThermoFisher) operating at 300 kV and equipped with a BioQuantum imaging filter (Gatan) and 20 e⁻V slit width. Data for endogenous SprA complexes were collected in counted super-resolution mode on a K3 detector (Gatan), real pixel size of 0.832 Å per pixel, using a total dose of 58.0–62.4 e⁻ A⁻² over 40 fractions. Data for reconstituted SprA–model substrate complexes were collected in counting mode on a K2 detector (Gatan), real pixel size of 0.822 Å per pixel, using a total dose of 51.2–52 e⁻ A⁻² over 20 fractions.

Lauber F., Deme J.C., Liu X., Kjær A., Miller H.L., Alcock F., Lea S.M, & Berks B.C. (2024). Structural insights into the mechanism of protein transport by the Type 9 Secretion System translocon. Nature Microbiology, 9(4), 1089-1102.

+ Open protocol

+ Expand

Cryo-EM Imaging of CcsBA Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

CcsBA cryo EM samples were prepared on quantifoil holey carbon grids (R2/2 300 mesh copper) and plunge frozen a Vitrobot Mark IV (ThermoFisher Scientific, Brno, CZ). Prior to plunge freezing the girds were plasma cleaned for 1 minute using a Gatan Solarus 950 (Gatan, Pleasanton, CA). The Vitrobot sample chamber was set to 4°C and 100 % humidity. 3 μL of purified CcsBA at a concentration of 2.8 mg/ml was applied to the plasma cleaned quantifoil grids and allowed to incubate for 20 seconds. Grids were then blotted for 2 seconds at a blot force of −1 and plunge frozen into liquid ethane. Vitrified samples were then imaged using a Cs-corrected Thermo Fisher Titan Krios G3 cryo-electron microscope (ThermoFisher Scientific, Eindhoven, NL) operating at an accelerating voltage of 300 kV equipped with a Gatan K2-Summit detector (Gatan, Pleasanton, CA) placed on a BioQuantum 968 GIF-quantum energy filter (Gatan, Pleasanton, CA) operating with a slit width of 20 eV. Data acquisition was automated using the EPU software (ThermoFisher Scientific, Brno, CZ) at a magnification of 105,000× which corresponds to a pixel size of 1.1 Å. Micrograph movies were recorded for 8s with 40 frames. This results in a frame rate of 0.2 sec per frame with a dose rate of 1.65 electrons per Å^{2 (link)} per frame (a total dose of 66 electrons per Å^{2 (link)}). The defocus was varied between −1 to −2.5 μm.

Mendez D.L., Lowder E.P., Tillman D.E., Sutherland M.C., Collier A.L., Rau M.J., Fitzpatrick J.A, & Kranz R.G. (2021). Cryo-EM of CcsBA reveals the basis for cytochrome c biogenesis and heme transport. Nature chemical biology, 18(1), 101-108.

+ Open protocol

+ Expand

Cryo-EM Sample Preparation and Imaging

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

EM grids (Lacey
Carbon Film, Electron Microscopy Sciences #LC200-Cu) were glow-discharged
(Emitech K350 unit at 20 mA for 30 s), deposited with 4 μL of
lipid dispersion, blotted, and then plunged into liquid ethane using
a Vitrobot (Mark IV, Thermo Fisher Scientific). Images were collected
on a Titan Krios G3 (Thermo Fisher Scientific) operated at 300 keV
equipped with a K3 detector and a 1067HD BioContinuum energy filter
(Gatan) with a 15 eV slit width. Dose-fractionated images were acquired
using SerialEM^{43 (link)} in low dose counting mode
with a total dose of 50 e/Å² at 2.16 Å/pixel
and 4 μm nominal defocus. Images were motion- and CTF-corrected
in Warp.^{44 (link)} Representative images were prepared
in ImageJ.^{45 (link)}

Fracassi A., Podolsky K.A., Pandey S., Xu C., Hutchings J., Seifert S., Baiz C.R., Sinha S.K, & Devaraj N.K. (2023). Characterizing the Self-Assembly Properties of Monoolein Lipid Isosteres. The Journal of Physical Chemistry. B, 127(8), 1771-1779.

+ Open protocol

+ Expand

Cryo-EM Imaging of Biomolecular Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individual cryo-EM images were collected on a Titan Krios G3 transmission electron microscope (Thermo Fisher Scientific) operated at 300 kV with a K2 Summit direct electron detector and Bioquantum energy filter (Gatan). All images were collected using the EPU software package (Thermo Fisher Scientific) with an applied defocus range of -3.5 µM and a magnified pixel size of 1.059 Å for the largest magnification of 130000x. The lower magnification grid overview and grid square images were collected at 3500- and 8000-fold magnification, respectively.

Hohle M.M., Lammens K., Gut F., Wang B., Kahler S., Kugler K., Till M., Beckmann R., Hopfner K.P, & Jung C. (2022). Ice thickness monitoring for cryo-EM grids by interferometry imaging. Scientific Reports, 12, 15330.

+ Open protocol

+ Expand

HPV16 Cryo-EM Sample Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HPV16 sample was assessed for purity and concentration before vitrification for cryo-EM data collection on the Penn State Titan Krios (https://www.huck.psu.edu/core-facilities/cryo-electron-microscopy-facility/instrumentation/fei-titan-krios). 3.5 µl of the purified virus sample was pipetted onto a glow-discharged R2/1 Quantifoil grid (Quantifoil Micro Tools GmbH, Jena, Germany), blotted for 2.5 s, and plunge-froze in liquid ethane using a Vitrobot Mark IV (Thermo Fisher, USA). Vitrified grids were imaged with the use of a Titan Krios G3 (Thermo Fisher, USA) under automated control of the FEI EPU software. An atlas image was taken at 165 × magnification, and suitable areas were selected for imaging on the FEI Falcon 3EC direct electron detector. The microscope was operated at 300 kV with a 70 μm condenser aperture and a 100 μm objective aperture. Magnification was set at 59,000 × yielding a calibrated pixel size of 1.1 Å. Four, nonoverlapping exposers were acquired per each 2-um-diameter hole of the grid with the beam in parallel mode, for an overall collection of 10,143 micrographs. The total dose per exposure was set to 60 e⁻/Å² (Supp. Table 1).

Goetschius D.J., Hartmann S.R., Subramanian S., Bator C.M., Christensen N.D, & Hafenstein S.L. (2021). High resolution cryo EM analysis of HPV16 identifies minor structural protein L2 and describes capsid flexibility. Scientific Reports, 11, 3498.

+ Open protocol

+ Expand

Cryo-EM Data Collection Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Data were collected on a Titan Krios G3 (Thermo Fisher) equipped with a K2 direct detector (Gatan) at 300 keV using the semi-automated data acquisition software EPU (Thermo Fisher). 40 frames with a dose of 1.09 ^e-/Å² per frame were collected in a defocus range of −0.4 to −3.5 µm. Magnification settings resulted in a pixel size of 1.045 Å/pixel. Frame alignment was executed with MotionCor2 (Zheng et al, 2017 ) and the estimation of the contrast transfer function (CTF) was performed with Gctf (Zhang, 2016 ).

Park E.N., Mackens-Kiani T., Berhane R., Esser H., Erdenebat C., Burroughs A.M., Berninghausen O., Aravind L., Beckmann R., Green R, & Buskirk A.R. (2023). B. subtilis MutS2 splits stalled ribosomes into subunits without mRNA cleavage. The EMBO Journal, 43(4), 484-506.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!