After 12 h of cultivation, the cultures were centrifuged at room temperature at 2000 rpm for 15 s, and the pellets were flash frozen in liquid N2 before RNA extraction, which was performed as described previously [18 (link)]. The ScriptSeq Complete Kit (Bacteria) (Epicentre Biotechnologies, Madison, WI, USA) was used to remove ribosomal RNA (rRNA) and to construct a strand-specific library. Briefly, rRNA was removed from 2.5 µg of total RNA. To generate strand-specific RNA-seq data, approximately 100 ng of rRNA-depleted RNA was fragmented and reverse transcribed with random primers containing a 5′ tagging sequence, followed by 3′ end tagging with a terminal-tagging oligonucleotide to yield dual-tagged, single-stranded cDNA. After magnetic-bead-based purification, the dual-tagged cDNA was amplified with PCR (15 cycles) using ScriptSeq Index PCR Primers (Epicentre Biotechnologies). The amplified RNA-seq libraries were purified with the AMPure XP system (Beckman Coulter, San Jose, CA, USA) and sequenced as 100-bp paired-end reads on the Illumina HiSeq 2500 platform (University of Edinburgh, UK). The data were analyzed was with Rockhopper [19 (link)], using the default settings for strand-specific analyses.
Scriptseq index pcr primers
Manufactured by Illumina
Sourced in United States
The ScriptSeq Index PCR Primers are a set of sequencing primers designed for use with Illumina's ScriptSeq library preparation kits. These primers enable the addition of index sequences to DNA fragments, which allows for the identification and separation of individual samples within a multiplexed sequencing run.
Automatically generated - may contain errors
Lab products found in correlation
Scriptseq v2 rna seq library preparation kit, by Illumina (9 mentions)
Hiseq 2000, by Illumina (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Bioanalyzer high sensitivity dna chip, by Agilent Technologies (3 mentions)
Hiseq 2500 platform, by Illumina (3 mentions)
Ampure xp system, by Beckman Coulter (2 mentions)
Ampure xp bead, by Beckman Coulter (2 mentions)
Rnalater, by Thermo Fisher Scientific (2 mentions)
Ribo zero, by Illumina (2 mentions)
Agilent 2100 bioanalyser, by Agilent Technologies (2 mentions)
Ampure xp, by Beckman Coulter (2 mentions)
Scriptseq complete kit, by Illumina (2 mentions)
Nextseq 500, by Illumina (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Scriptseq complete kit bacteria, by Illumina (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Ribo zero rrna removal kit, by Illumina (1 mentions)
Scriptseq v2 kit, by Illumina (1 mentions)
Rneasy mini column, by Qiagen (1 mentions)
15 protocols using scriptseq index pcr primers
1
Strand-specific RNA-seq Library Preparation
2
RNA-seq Profiling of E. faecium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 3 × 107 cfu of E. faecium E745 were inoculated into 14 ml of BHI broth and heat-inactivated serum, and grown at 37 °C until exponential phase. Cultures were centrifuged at room temperature (15 s; 21.380 g), and pellets were flash frozen in liquid N2 prior to RNA extraction, which was performed as described previously [21 (link)]. The ScriptSeq Complete Kit (Bacteria) (Epicentre Biotechnologies, WI) was used for rRNA removal and strand-specific library construction. Briefly, rRNA was removed from 2.5 μg of total RNA. To generate strand specific RNA-seq data, approximately 100 ng of rRNA-depleted RNA was fragmented and reverse transcribed using random primers containing a 5′ tagging sequence, followed by 3′ end tagging with a terminal-tagging oligo to yield di-tagged, single-stranded cDNA. Following magnetic-bead based purification, the di-tagged cDNA was amplified by PCR (15 cycles) using ScriptSeq Index PCR Primers (Epicentre Biotechnologies, WI). Amplified RNA-seq libraries were purified using AMPure XP System (Beckman Coulter) and sequenced by a 100 bp paired end reads sequencing run using the Illumina HiSeq 2500 platform (University of Edinburgh, United Kingdom). Data analysis was performed using Rockhopper [64 (link)] using the default settings for strand specific analysis.
3
RNA-Seq Library Preparation from Dissected Tissues
4
Maize Leaf RNA-Seq Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
During August 2014 maize leaf samples were collected from Kenya and Ethiopia, stored on dry ice in RNA-later (Ambion), then RNA was extracted using Trizol (Ambion) according to manufacturer’s instructions. An additional Rwandan maize leaf RNA sample was received from FERA (UK). Ribosomal RNA (rRNA) depletion was performed with Ribo-Zero Magnetic Kit (Plant Leaf-Epicentre). Indexed stranded libraries were constructed using Scriptseq V2 RNA-Seq Library Preparation kits and Scriptseq Index PCR primers (Epicentre). Purification steps were performed using Agencourt AMPure XP beads. Library quantity and quality were checked using Qubit (Life Technologies) and on a Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies). Libraries were sent to Beijing Genomics Institute for 100 bp paired-end sequencing on one lane of a HiSeq 2000 (Illumina).
5
Strand-Specific RNA-Seq Protocol
6
Fragmented DNA Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all samples, we started with 100–300 ng of double-stranded, fragmented DNA. We end-repaired and 5′-phosphorylated using the End Repair Module (New England Biolabs #E6050L), A-tailed with Klenow exo- (New England Biolabs #M0212S), and ligated to adapters (8.3 nM) with a Quick Ligase Kit (New England Biolabs #M2200S). We PCR-amplified using Phusion 2X HF master mix (New England Biolabs #M0531S) in a 50-μl total volume containing 200 nM of each primer. Thermocycler conditions were as follows: an initial denaturation at 98° for 30 sec; no more than 12 cycles of 98° for 30 sec, 65° for 30 sec, and 72° for 30 sec; and a final extension at 72° for 5 min. We purified DNA between each enzymatic treatment using Agencourt AMPure XP at a ratio of 1.8:1, except after PCR, where the ratio was 0.9:1. Prior to sequencing, we selected amplicons corresponding ∼150-bp inserts by gel electrophoresis on a 2.5% agarose gel and purified using a QIAquick gel extraction kit (Qiagen #28704). We used indexed PCR primers from the ScriptSeq Index PCR primers (Epicentre, #RSBC10948 and #SSIP1202) at a concentration of 200 nM. We used a Y adapter of the following two oligos at a concentration of 8.3 nM each: /5Phos/GATCGGAAGAGCACACGTCT and ACACTCTTTCCCTACACGACGCTCTTCCGATCT.
7
RNA-seq Library Preparation for Dinoflagellates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten micrograms of total RNA for D. excentricus and O. panamense was resolved by electrophoresis on a 4% polyacrylamide/8 M urea denaturing gel. The gel section, containing RNA species from 300–750 nt in length, was excised and RNA was eluted from the gel slice followed by ethanol precipitation. Size-selected RNA was used for cDNA library construction with the ScriptSeq v2 RNA-Seq Library Preparation Kit (Epicentre) following the manufacturer's instructions. The cDNA libraries were constructed with ScriptSeq Index PCR Primers (Epicentre) and indexed cDNA libraries were pooled for a single multiplexed single-end 50-bp sequencing run on a HiSeq 2000 (Illumina).
8
Ribosomal RNA Depletion and RNA-Seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ScriptSeq complete kit (Epicentre, Illumina, Madison, WI, USA), a combined kit for the ribosomal (rRNA) depletion Ribo-Zero Kit (Bacteria) (Epicentre, Illumina, Madison, WI, USA) and cDNA library construction kit, ScriptSeq v2 RNA-Seq library preparation kit (Epicentre, Illumina, Madison, WI, USA) was used for this purpose. A total of 5 µg of RNA was used for rRNA depletion by using Ribo-Zero (Epicentre, Illumina, Madison, WI, USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH, Hilden, Germany) Clean-up kit. The Ribo-Zero treated RNA was quantified by using Agilent Bioanalyzer RNA 6000 Pico Kit (Agilent Technologies, CA, USA) and further used for the cDNA synthesis by using ScriptSeq v2 RNA-Seq kit (Epicentre, Illumina, Madison, WI, USA). The cDNA was purified using AMPure XP (Beckman Coulter, Brea, CA, USA) beads and multiplexed by using ScriptSeq Index PCR Primers (Epicentre, Illumina, Madison, WI, USA). cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems, Wilmington, MA, USA). Finally, six libraries, which contain the biological triplicate of S. maltophilia
9
Maize Leaf RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We collected maize leaf samples from Kenya and Ethiopia in August 2014 (Table S1 ), storing samples in RNA-later (Ambion) on dry ice. To extract RNA, we used Trizol (Ambion) according to manufacturer’s instructions. We depleted ribosomal RNA with the Ribo-Zero Magnetic Kit (Plant Leaf - Epicentre). To generate indexed stranded libraries, we used Scriptseq V2 RNA-Seq Library Preparation kits and Scriptseq Index PCR primers (Epicentre). Library concentration and quality were confirmed using Qubit (Life Technologies) and a Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies). Beijing Genomics Institute performed 100 bp paired-end sequencing on one lane of a HiSeq 2000 (Illumina).
10
RNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using Trizol (Ambion) as per manufacturer’s instructions. Ribosomal RNA (rRNA) depletion was performed with Ribo-Zero Magnetic Kits (Plant Leaf – Epicentre), and depletion confirmed on a pre-cast 6% TBE-urea gel (Novex, Life Technologies). Indexed stranded libraries were constructed using Scriptseq V2 RNA-Seq Library Preparation kits (Epicentre) and Scriptseq Index PCR primers (Epicentre). Purification steps were performed using Agencourt AMPure XP beads. Library quantity and quality were checked using Qubit (Life Technologies) and on a Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies). Libraries were sent to Beijing Genomics Institute for 100 bp paired-end sequencing on one lane of a HiSeq 2000 (Illumina).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!