Taq polymerase

We used 20 μL of the supernatant for the bisulfite modification which was performed using the EZ DNA methylation kit according to the manufacturer’s protocol (Zymo Research, Irvine, CA, USA). In order to measure input DNA (bisulfite-modified DNA), we performed Alu-based MethyLight control reaction which is a CpG-independent, bisulfite-specific control reaction [2 (link)]. We determined the threshold cycle (C(t) value) of this reaction in which the Alu reaction fluorescence was detected. To keep the C(t) value of bisulfite-modified DNA samples in the range from 18 to 20, we added distilled water to dilute bisulfite-modified DNA samples with C(t) values lower than 18. MethyLight PCR was performed in a 25-μL reaction volume with 200 μM dNTPs, 0.3 μM forward and reverse PCR primers, 0.1 μM probe, 3.5 mM MgCl₂, 0.01% Tween 20, 0.05% gelatin, and 0.2 units of Taq polymerase on a 96-well plate (BioRad) using the following PCR program: 95 °C for 10 min, then 50 cycles of 95 °C for 15 s followed by 60 °C for 1 min.

Total cellular RNA was prepared using Qiagen RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturers' instruction. Residual DNA was eliminated using the Qiagen RNase-Free DNase Set. cDNAs were synthesized from 2 μg of RNA with the Superscript II™ Reverse Transcriptase (Invitrogen). PCR was performed using 1 μL of cDNA in the PCR buffer supplemented with 0.2 mM of dNTP, 2.5 units of Taq polymerase (Biorad and ThermoFisher Scientific), and 0.5 μM of each sense and antisense primer. The following primers were used: SSTR2 forward 5′-GGTGAAGTCCTCTGGAATCC-3′ and reverse 5′-CCATTGCCAGTAGACAGAGC-3′; NET forward 5′-CTCAAGGAGGCCACGGTATGGATCG-3′ and reverse 5′-ACCTGGAAGTCATCAGCCAGTCCGG-3′; GAPDH forward 5′-CTGTCCAGTTAATTTCTGACC-3′ and reverse 5′-CTTTGTACATGGTATTCACCAC-3′. PCR products were run on a 1.5% agarose (Invitrogen) with a 100 bp marker (Thermo Fisher Scientific) and stained with ethidium bromide. Gel pictures were taken using the AlphaImager™ 2200 (Alpha Innotech, Kasendorf, Germany).

Total RNA was isolated using the TRI reagent (Molecular Research Center) and reverse transcribed. The generated cDNA was PCR amplified with Taq polymerase (iNtRON) and the target mRNAs were quantified by quantitative RT-PCR (qRT-PCR) using a CFX Connect (Bio-Rad) and SYBR Premix Ex Taq (Takara Bio). The utilized PCR primers and conditions are presented in Supplementary Table S2. For Western blotting, total cell lysates were obtained with RIPA buffer and three freeze-thaw cycles. Western blot analyses were performed to detect the indicated proteins. The utilized antibodies were purchased from BD Bioscience (anti-β-catenin, anti-ERK, and anti-GSK3β), Abcam (anti-β-actin), and Cell Signaling (anti-AKT, anti-pAKT, anti-p38, anti-pp38, anti-pERK, anti-pGSK3β, anti-GAPDH, anti-BCL2, anti-BAX, anti-RUNX2, anti-p53, and anti-TAZ).

The eluate from the protease incubation spin filtration was added to 10 pmol AGR2 immobilized on Streptavidin M-280 magnetic beads (Dynal/ThermoFisher Scientific) in 500 μL selection buffer (pH 6.5). The magnetic beads were washed after one hour at RT and resuspended in a 1 mL PCR reaction. The fusions were amplified by PCR using Taq-polymerase (BioRad) and subcloned into the TOPO-TA vector (Invitrogen) followed by transformation into TOP10 competent cells (Invitrogen). Individual clones were Sanger sequenced (Laragen). Binding was measured by scintillation counting of ³⁵S-methionine labeled, oligo-dT cellulose purified fusions. All radiolabeled binding assays were performed at RT.

To evaluate XBP1 alternative splicing cDNA was used as a template for PCR amplification using XBP1-specific primers (forward: 5′TTACGAGAGAAAACTCATGGCC3′; reverse: 5′GGGTCCAAGTTGTCCAGAATGC3′). PCR was performed using Taq polymerase (Bio-Rad, Hercules, CA, USA), and the products were separated by agarose gel electrophoresis and visualized with GelGreenTM (Invitrogen, Waltham, MA, USA). Results were acquired at ChemiDoc touch (Bio-Rad, Hercules, CA, USA).

For molecular characterization genomic DNA of the cyanobacteria isolate was extracted using the traditional xanthogenate technique (Tillett and Neilan, 2000 (link)). For the partial amplification of the 16S rRNA gene, a forward primer (359F, 5'-GGG GAA TYT TCC GCA ATG GG-3') and a reverse primer (781R, 5'-GAC TAC TGG GGT ATC TAA TCC CAT T-3') were used (Nübel et al., 1997 (link)). The 16S rRNA amplification was performed using 25µl aliquots containing 30–50µg DNA template, 200µM dinucleotide triphosphates, 0.4µM of forward and reverse primers, 1 U/µl Taq Polymerase and 1.5µM MgCl2, (BioRad, DNA Engine, Peltier Thermal Cycler). The reaction mixture was incubated in a Thermal cycler for DNA amplification (Singh P, et al., 2015 (link)). The amplified products were sequenced by Sanger’s method and the obtained sequence was compared with the NCBI database using BLAST tool. MEGA 11 software was used for making maximum likelihood tree for phylogenetic analysis (Guindon and Gascuel, 2003 (link)).

The conventional PCR assay was performed using a Bio-Rad MyCycler^TM Thermal cycler with a 20 µL total reaction volume composed of 50 ng DNA template, 200 nM of each primer, 0.5 U TaKaRa Taq polymerase, 1.6 µL of dNTP mixture, 1× PCR buffer (Mg²⁺ Plus), and sterile water. The cycling parameters were initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, elongation at 72 °C for 20 s, and a final elongation at 72 °C for 2 min. The PCR products were visualised on a 2% agarose gel stained with GelRed (Biotium, Fremont, CA, USA) in 1 × Tris-acetate-EDTA buffer and analysed using a GelDoc 1000 gel Documentation System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).