16s metagenomic sequencing library preparation

Fecal DNA extraction was performed using the Spin stool DNA kit (Stratec Molecular, Berlin, Germany), according to manufacturer's instructions. For each sample, 25 ng of extracted DNA was used to construct the sequencing library. The V3–V4 hypervariable regions of the bacterial 16S rRNA were amplified with a two-step barcoding approach according to the Illumina 16S Metagenomic Sequencing Library Preparation (Illumina, San Diego, CA, USA). For library preparation, DNA samples were amplified with dual-index primers using a Nextera XT DNA Library Preparation Kit (Illumina). Library concentration and quantification were determined using a KAPA Library Quantification Kit (Kapa Biosystems, Woburn, MA, USA) and Agilent 2100 Bioanalyzer System (Agilent, Santa Clara, CA, USA), respectively. The libraries were pooled and sequenced with a MiSeq platform (Illumina) for 2 × 250 base paired-end reads and a total of 2.5 Gbases raw reads were obtained.

Total bacterial DNA extraction was performed using the Spin stool DNA kit (Stratec Molecular, Berlin, Germany), according to the manufacturer’s instructions and amplified by PCR. 25 ng of DNA extracted from each stool sample was utilized to construct a sequencing library. 16S rRNA gene amplicon libraries were performed with a two-step barcoding approach according to Illumina 16S Metagenomic Sequencing Library Preparation (Illumina, San Diego, CA, USA). In the first-step PCR, 16S rRNA gene of all bacteria was amplified as described by Klindworth et al. [55 (link)]. Then, for library preparation, DNA samples resulting from first PCR step were amplified with dual-index primers using Nextera DNA Library Preparation Kit (Illumina). Each sample possessed specific barcode sequences at the 5′- and 3′-end of the PCR amplicon to discriminate among each other in the pooled library. Library concentration and exact product size were measured using a KAPA Library Quantification Kit (Kapa Biosystems, Woburn, MA, USA) and an Agilent 2100 Bioanalyzer System (Agilent, Santa Clara, CA, USA), respectively.

Nasal swabs were collected and stored at −80 °C following standard porcedures. DNA was extracted using QIAamp^® UCP Pathogen Mini (Qiagen, Hilden, Germany) following the manufacturer’s guidelines. The extracted DNA was stored at −20 °C and later shipped in cold packs to the sequencing service facility Personal Genomics Srl (Verona, Italy) to perform qualitative and quantitative checks, PCR amplification, and second-generation sequencing analysis. In particular, DNA quantification was performed by the Qubit dsDNA BR assay kit (Thermofisher Scientific, Waltham, MA, USA). Libraries were generated by following Illumina 16S Metagenomic Sequencing Library Preparation (Illumina, San Diego, CA, USA). Bacterial communities were investigated through amplicon sequencing analysis of the 16S rRNA gene hypervariable regions V3-V4, amplified with the primer pair Pro341F (5′-CCTACGGGNBGCASCAG-3′) and Pro805R (5′-GACTACNVGGGTATCTAATCC-3′). The obtained libraries were evaluated by Labchip DNA High Sensitivity (Perkin Elmer, Waltham, MA, USA), quantified by the Qubit dsDNA BR assay kit (Thermofisher Scientific), and then sequenced through the Illumina MiSeq platform (Illumina) using a paired-end library of 300 bp insert size.

The amplicon for 16S V3V4 regions was generated in two-step PCR methods following “Illumina 16S metagenomic sequencing library preparation”^{64 (link),65} . The first PCR was run for 30 cycles, followed by beads purification of positive amplicons, and indexing via second PCR (12 cycles). Paired-end sequencing (v3 kit, 600 cycles) was performed with Illumina MiSeq platforms (Illumina Inc., CA, USA). The PCR conditions are available in supplementary data (Supplementary data M1.2).

Five hundred mg of root samples from 10 ST9-treated and untreated plants at T2 and T4 time points were used to extract DNA and perform microbiome analysis. DNA was extracted using the PowerSoil Kit (Qiagen, Hilden, Germany) following supplier instructions. For the 16S amplicon libraries preparation, 12.5 ng of DNA, quantified using Nanodrop, was used for each sample to prepare the 16S rRNA amplicon libraries. Library preparation was done using the Illumina methodology following the 16S Metagenomic Sequencing Library Preparation protocol (https://emea.support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf, accessed on 17 July 2021). Sequencing was performed at CBM scrl (Trieste, Italy) with MiSeq sequencing platform.

For each of the four different community types: (1) Isolate, (2) Mixed, (3) Fecal, and (4) ATCC Reference Standard, the ITS1, ITS2, and 18S regions were amplified in triplicate using gene specific primers listed in Table 1 with the Illumina adaptor sequence added to the 5’ end (5′-TCGTCGGCAGCGTCAGATGTG TATAAGAGACAG—ITS3-3′) and (5′GCTTCGTGGGCTCGGAGATGTGTATAAG AGACAG—ITS4-3′). The Illumina 16S Metagenomic Sequencing Library Preparation protocol was utilized and samples were sequenced on the Illumina MiSeq platform (https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf).

10 NHCLs and 3 normal samples were tested for NGS analysis. DNA extracted from NHCL and normal samples was used as a template. The 16S rRNA amplicon libraries (V4 region) were prepared according to the Illumina 16S Metagenomic Sequencing Library Preparation protocol with the primers 515F (5′-TCGTCCGCCAGCGTCAGATGTGTATAAGAGACAG-GTGYCAGCMGCCGCGGTAA-3′) and 806R (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACNVGGGTWTCTAAT-3′). The libraries were sequenced on the Illumina MiSeq platform to generate paired end (301 bp × 2) sequence reads. Phylogenetic analysis was performed using the Quantitative Insights into Microbial Ecology 2 (QIIME 2) platform version 2019.7 [29 (link)] Raw sequence data were demultiplexed denoised with DADA2 [30 (link)] using the parameters p-trim-left-f 10, p-trim-left-r 10, p-trunc-len-f 200, and p-trunc-len-r 150. Amplicon sequence variants (ASVs) were assigned taxonomy using the feature classifier classify-sklearn and the SILVA 132 99% 515F/806R reference sequences [31 (link)].