Reverse transcription master mix

cDNA was prepared from the extracted RNA by reverse transcription using 5 µL Reverse Transcription Master mix (Fluidigm, California, USA). The resulted cDNA was then pre-amplified by using PreAmp Master mix (Fluidigm) with 7 custom-designed primers (designed by using Delta Gene assays according to the manufacturer's instructions). The pre-amplification reactions were performed with BioRad MyCycler Thermal Cycler (Bio-Rad Laboratories, Inc.) using the following amplification conditions: 95 °C for 2 min, followed by 14 cycles of 95 °C for 15 s and 60 °C for 4 min.

PBMCs were activated for 5 hr with plate-bound anti-CD3 (clone OKT3; Thermo Fisher Scientific). RNA was extracted from flow-sorted naive CD8⁺ T cells (n = 300 per condition) using a NucleoSpin RNA XS Kit (Macherey-Nagel), and cDNA was synthesized using Reverse Transcription Master Mix (Fluidigm). Specific targets were amplified using PreAmp Master Mix (Fluidigm). Gene expression was assessed using a BioMark HD System (Fluidigm) with EvaGreen Supermix (Bio-Rad). RNA expression levels were calculated using the 2^−ΔΔCT method with reference to a housekeeping gene (human 18S) (18 (link)).

Total RNA was isolated as above from CLL cells, and complementary DNA was obtained using the Reverse Transcription Master Mix (Fluidigm Corporation). Samples were processed to Specific Target Amplification using the PreAmp Master Mix (Fluidigm Corporation) and the corresponding TaqMan Gene Expression Assays (Life Technologies). PCR was run as recommended by the manufacturer in a 96.96 Dynamic Array-Gene Expression IFC (Fluidigm Corporation). The relative expression of each gene was quantified by the comparative cycle threshold (Ct) method (ΔΔCt), using GUSB as endogenous control and taking as a calibrator the Universal Human Reference RNA (Life Technologies).

Total RNA was isolated with TRIzol from ear samples, and reverse transcription and pre-amplification were performed with Reverse Transcription Master Mix and Preamp Master Mix (Fluidigm, South San Francisco, CA, USA), respectively. Quantitative real-time PCR was carried out in the Dynamic Arrays integrated fluidic circuit of a BioMarkHD system (Fluidigm) with specific primer pairs as indicated in Supplementary Table T1.

Experiments were conducted using unsorted Ishikawa and Hec-1a cells and sorted cancer stem cells according to CD133 expression and ALDH activity, which had been maintained in normal growth media with or without supplemental metformin. RNA extraction was performed using the RNeasy Micro Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol.
Reverse transcription of 1.5ng of RNA was performed with the Reverse Transcription Mastermix (PN 100-6297, Fluidigm, San Francisco, USA). The cDNA formed was immediately pre-amplified using Taqman gene expression arrays (Supplementary Table S1, Fisher Scientific, Loughborough, UK) and Taqman PreAmp Mastermix (Fisher Scientific, Loughborough, UK).
RT-qPCR was performed using the Flex Six™ Integrated Fluidic Circuit (IFC, Fluidigm, San Francisco, CA, USA). Pre-amplified cDNA was added to a sample pre-mix composed of Taqman Fast Advanced MasterMix (2×, PN 4444557, Fisher Scientific, Loughborough, UK) and 20× GE Sample Reagent (PN 100-6311, Fluidigm, San Francisco, CA, USA). Assays and sample solutions were pipetted into the designated IFC inlets. RT-qPCR was performed using the BiomarkHD system, with data analysed using the Biomark Real-Time PCR Analysis Software.

Total RNA was extracted from expanded T cells that were seeded, TCR-activated and treated/non-treated in the same conditions as for Western blot analysis above using the RNeasy Mini kit (Qiagen). cDNA was then synthesized using the cDNA Preparation with Reverse Transcription Master Mix (Fluidigm, PN 100-6297), followed by PCR amplification using the KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems), both according to manufacturers’ protocols. Primers (5’ to 3’) used for amplification of XBP1 splicing variants and housekeeping gene include: sXBP1 forward CTGAGTCCGAATCAGGTGCAG; uXBP1 forward: CAGCACTCAGACTACGTGCA; tXBP1 forward: TGGCCGGGTCTGCTGAGTCCG; reverse primer used for all XBP1 variants: ATCCATGGGGAGATGTTCTGG; HPRT forward: CCCTGGCGTCGTGATTAGTG; HPRT reverse: TCGAGCAAGACGTTCAGTCC. PCR products were then run on a 2% agarose gel and imaged on a ChemiDoc™ MP Imaging System (Biorad).